TkA08G095350 | RubberDandelionOmics

Gene overview

TkA08G095350

Reference: TK1151 Chr: Chr08 Coordinates: 24628622-24632049 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1646 bp · TkA08G095350|TK1151|cDNA

CTTCTCCCCTGCGATTTGGTCTGTGGAGCTCGATTTCGTGAGTAAAATCATTGATATGGCGCACCTGAATCCCTCGCTCTTACTTTTCCTATCTCTAAACTTGCTCCATTTGCTTCATACGGTCATTGCTAGAGGCGGTGAACGTGATTCAGGTTTTGTGGATATAACATATGCTGCTTCAGGAAGGCATTTGTCCGAAGAAACCCACTTTCAAAAACTTAATAAGTTAGCTCAGGGGTATATGACTAATTCTGATCTTG...

CDS

Download CDS FASTA

1458 bp · TkA08G095350|TK1151|CDS

ATGGCGCACCTGAATCCCTCGCTCTTACTTTTCCTATCTCTAAACTTGCTCCATTTGCTTCATACGGTCATTGCTAGAGGCGGTGAACGTGATTCAGGTTTTGTGGATATAACATATGCTGCTTCAGGAAGGCATTTGTCCGAAGAAACCCACTTTCAAAAACTTAATAAGTTAGCTCAGGGGTATATGACTAATTCTGATCTTGAGAAGGCTATCAAGGCATTCCATGGTAGATGTGGTCACATTTCCAGAATATACAG...

Protein

Download Protein FASTA

485 aa · TkA08G095350|TK1151|PROTEIN

MAHLNPSLLLFLSLNLLHLLHTVIARGGERDSGFVDITYAASGRHLSEETHFQKLNKLAQGYMTNSDLEKAIKAFHGRCGHISRIYSIGTSVVGVPLWVMEISNNPGKEEAKPAFKFIGNVHGDEPVGRELLLLLANWLCDNYNKDPLATLIVDNVHLHILPSMNPDGFSLRKRGNAYNIDLNRDFPDQFFPINDDMDERQPETKAIMRWLKDIRFTASASLHGGALVANYPWDGTEDKSKSYFACPDDETFKYMAKLYS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G095350`
TK1151 ID	TkA08G095350
OH-1004 ID	LXL04_031215
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.300
Protein coverage (%)	TK1151 88.454 / OH-1004 45.253 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G095350

Location Chr08:24628622-24632049 (-)

Description Similar to Alpha-isocomene synthase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71696`	Possesses in vitro carboxypeptidase activity against the C- terminal arginine and lysine residues.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031215 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016102 diterpenoid biosynthetic process Biological Process

GO:0051762 sesquiterpene biosynthetic process Biological Process

GO:0000287 magnesium ion binding Molecular Function

GO:0010333 terpene synthase activity Molecular Function

GO:0052682 epi-cedrol synthase activity Molecular Function

GO:0080016 (-)-E-beta-caryophyllene synthase activity Molecular Function

KEGG gene cross-reference

ag:AAF80333

ag:AAL79181

ag:AFM43735

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.376

Rank 1 · TkA08G095350 · TK1151

Lysosome / Vacuole0.208

Rank 2 · TkA08G095350 · TK1151

Endoplasmic reticulum0.192

Rank 3 · TkA08G095350 · TK1151

Cytoplasm0.145

Rank 4 · TkA08G095350 · TK1151

Cell membrane0.119

Rank 5 · TkA08G095350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24942Fn3_Dep-1_1st56-86 aa

PF00246Peptidase_M1469-325 aa

PF24827AstE_AspA_cat118-211 aa

PF10994DUF2817156-190 aa

PF24942Fn3_Dep-1_1st237-266 aa

PF13620CarboxypepD_reg375-414 aa

PF24942Fn3_Dep-1_1st379-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G095350	`PF24942`	Fn3_Dep-1_1st	56	86	0.051	14.3
TkA08G095350	`PF00246`	Peptidase_M14	69	325	5e-63	214.1
TkA08G095350	`PF24827`	AstE_AspA_cat	118	211	0.0031	17.8
TkA08G095350	`PF10994`	DUF2817	156	190	0.0024	18.2
TkA08G095350	`PF24942`	Fn3_Dep-1_1st	237	266	0.051	14.3
TkA08G095350	`PF13620`	CarboxypepD_reg	375	414	0.036	15.1
TkA08G095350	`PF24942`	Fn3_Dep-1_1st	379	411	0.051	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M9H7`	Arabidopsis thaliana	sp\|Q9M9H7\|SOL1_ARATH Carboxypeptidase SOL1	63.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card