Gene Card
Gene overview
cDNA / CDS / Protein Sequences
798 bp · TkA08G084490|TK1151|cDNA
ATGATTGACTCGGCTGCCTTCTTGGGGCTACGGTACAAATACATGGCAGCAATTTTCACGTCAGTGATAAACAAGTTTAAAGAAATGATAGACAAAGAATTGACTGAATTTAAAAAACTTGATGAAAATGGAAGGGCAAAGTTACTTGCAGAAGCCGAATCCAAAAATTTGAAGAATAAAAGGAAACGAGGTGGAAGAATAGATTCTGAAGTTTGTTCTAATATTCTAAAATTGGTGCAGTTGAATTTGAAAGGGGCACG...
798 bp · TkA08G084490|TK1151|CDS
ATGATTGACTCGGCTGCCTTCTTGGGGCTACGGTACAAATACATGGCAGCAATTTTCACGTCAGTGATAAACAAGTTTAAAGAAATGATAGACAAAGAATTGACTGAATTTAAAAAACTTGATGAAAATGGAAGGGCAAAGTTACTTGCAGAAGCCGAATCCAAAAATTTGAAGAATAAAAGGAAACGAGGTGGAAGAATAGATTCTGAAGTTTGTTCTAATATTCTAAAATTGGTGCAGTTGAATTTGAAAGGGGCACG...
Protein
Download Protein FASTA265 aa · TkA08G084490|TK1151|PROTEIN
MIDSAAFLGLRYKYMAAIFTSVINKFKEMIDKELTEFKKLDENGRAKLLAEAESKNLKNKRKRGGRIDSEVCSNILKLVQLNLKGARAILGKAIGMAPKYKKYIEIELQLGNIDRCRKLYEKYLEWSPENCYAWSKYAELERSLSETERARAIFELAIAQPALDMLELLWKAYIDFKIAEGEFERTRQLYERLLPYKAFEGVFENAINYYRTSASEQKEERAMLLEEWLNMETSFGELGDVGLVRAKLPKKLKKIRQIEL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G084490 |
|---|---|
| TK1151 ID | TkA08G084490 |
| OH-1004 ID | LXL04_005786 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 70.000 |
| Protein coverage (%) | TK1151 69.434 / OH-1004 31.616Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G084490 |
|---|---|
| Location | Chr08:21770571-21775010 (+) |
| Description | Similar to CRNKL1: Crooked neck-like protein 1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000245 spliceosomal complex assembly Biological Process GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process GO:0000398 mRNA splicing, via spliceosome Biological Process GO:1990416 cellular response to brain-derived neurotrophic factor stimulus Biological Process GO:1990830 cellular response to leukemia inhibitory factor Biological Process GO:0000974 Prp19 complex Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005681 spliceosomal complex Cellular Component GO:0005829 cytosol Cellular Component GO:0016607 nuclear speck Cellular Component GO:0071006 U2-type catalytic step 1 spliceosome Cellular Component |
| KEGG gene cross-reference | dme:Dmel_CG3193 dre:393920 hsa:51340 mmu:66877 rno:100910202 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13174TPR_611-26 aaPF17755UvrA_DNA-bind13-66 aaPF23240HAT_PRP39_N33-38 aaPF13174TPR_682-95 aaPF07719TPR_282-99 aaPF13428TPR_1483-100 aaPF29376PRP6_TPR83-160 aaPF14559TPR_1983-138 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G084490 | PF13174 | TPR_6 | 11 | 26 | 0.36 | 12.3 |
| TkA08G084490 | PF17755 | UvrA_DNA-bind | 13 | 66 | 0.12 | 13.4 |
| TkA08G084490 | PF23240 | HAT_PRP39_N | 33 | 38 | 1.9e-12 | 48.3 |
| TkA08G084490 | PF13174 | TPR_6 | 82 | 95 | 0.36 | 12.3 |
| TkA08G084490 | PF07719 | TPR_2 | 82 | 99 | 0.41 | 11.6 |
| TkA08G084490 | PF13428 | TPR_14 | 83 | 100 | 5e-07 | 30.5 |
| TkA08G084490 | PF29376 | PRP6_TPR | 83 | 160 | 1.5e-05 | 24.6 |
| TkA08G084490 | PF14559 | TPR_19 | 83 | 138 | 5.2e-05 | 24.2 |
| TkA08G084490 | PF13181 | TPR_8 | 83 | 99 | 5.7e-05 | 23.7 |
| TkA08G084490 | PF23241 | HAT_PRP39_C | 99 | 158 | 4.3e-09 | 37.3 |
| TkA08G084490 | PF05843 | Suf | 99 | 184 | 6.8e-06 | 25.6 |
| TkA08G084490 | PF23240 | HAT_PRP39_N | 100 | 196 | 1.9e-12 | 48.3 |
| TkA08G084490 | PF23231 | HAT_Syf1_CNRKL1_C | 100 | 222 | 2.4e-09 | 37.2 |
| TkA08G084490 | PF13428 | TPR_14 | 101 | 125 | 5e-07 | 30.5 |
| TkA08G084490 | PF30153 | TPR_YpiA_C | 101 | 129 | 1.7 | 10.1 |
| TkA08G084490 | PF23231 | HAT_Syf1_CNRKL1_C | 102 | 121 | 2.4e-09 | 37.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.