TkA08G078280 | RubberDandelionOmics

Gene overview

TkA08G078280

Reference: TK1151 Chr: Chr08 Coordinates: 20109115-20114527 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2351 bp · TkA08G078280|TK1151|cDNA

AATTGATCAAACACTACAAACTAATTTATGAGTTTATTACATTTTGGGTATGATTAATCTATTTTGGGCTGGTATTGCCATATGGGCTTTCACATATCCTTAGCCCACTATCGTGAAGCAATAAAGACCAGTTTCTGTCGGATAATAAAACGGGTCATTCCCAACATTTACCTCCTTCATGATTCTGAACAACTGTTTTCACACCACCATCGATACGGTTGCTGGACTTGAATTCATCTGGAACTCTTCGATTAGCTTCT...

CDS

Download CDS FASTA

1854 bp · TkA08G078280|TK1151|CDS

ATGTCTGAAGTTCCGTCGTTGATCACTTTATGCATAGGCGCAATCAAAGATGCGATCCTTGATGAAAACGGCAATTTACCTTATGTTTACAAACTTCCTGCTGAATTGTTTGATCAACTCTTACCTAACCTACCTCCATTGGCACTGCAGAATCTACAGGACGCCATGCCATCAGTTAGCTTTAGTGATCATGATTTCGATGATGATAGCTTAAAACCTTCAAAAAAACGGAAAAGATCTGAGAACTTTGATATAGCATG...

Protein

Download Protein FASTA

617 aa · TkA08G078280|TK1151|PROTEIN

MSEVPSLITLCIGAIKDAILDENGNLPYVYKLPAELFDQLLPNLPPLALQNLQDAMPSVSFSDHDFDDDSLKPSKKRKRSENFDIAWKTLYESRWSDVQKFTTDSLPEDDSTTNWQQIYWERHLQNCLDAVAEMVQITLFDGFLGDVEISDALLKSITYEGHLSRPKNYLKLDYHCERFGLYARCVRLQSVHCVAEIGHLLRKSRLQYLETHWIKSKEQVDGLCKLLDQNKDTLSTLEFLHCKLPASLVTAICESLFIKG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G078280`
TK1151 ID	TkA08G078280
OH-1004 ID	LXL04_018696
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G078280`
Location	Chr08:20109115-20114527 (-)
Description	Similar to NLRP5: NACHT, LRR and PYD domains-containing protein 5
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_018696` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006887 exocytosis Biological Process GO:0007015 actin filament organization Biological Process GO:0032880 regulation of protein localization Biological Process GO:0040019 positive regulation of embryonic development Biological Process GO:0051293 establishment of spindle localization Biological Process GO:0051302 regulation of cell division Biological Process GO:0051656 establishment of organelle localization Biological Process GO:0140089 protein storage Biological Process GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component
KEGG gene cross-reference	bta:493717 cbr:CBG_23501 cel:CELE_F28C1.3 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.476

Rank 1 · TkA08G078280 · TK1151

Cytoplasm0.415

Rank 2 · TkA08G078280 · TK1151

Mitochondrion0.103

Rank 3 · TkA08G078280 · TK1151

Cell membrane0.062

Rank 4 · TkA08G078280 · TK1151

Endoplasmic reticulum0.038

Rank 5 · TkA08G078280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12799LRR_443-53 aa

PF13516LRR_659-71 aa

PF28800DUF846399-115 aa

PF00560LRR_1234-249 aa

PF29255LRR_NLRC3290-465 aa

PF29265LRR_CARMIL295-402 aa

PF13855LRR_8297-337 aa

PF00560LRR_1298-309 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G078280	`PF12799`	LRR_4	43	53	0.0022	18.9
TkA08G078280	`PF13516`	LRR_6	59	71	6.2e-05	23.5
TkA08G078280	`PF28800`	DUF8463	99	115	0.25	12.0
TkA08G078280	`PF00560`	LRR_1	234	249	4.8e-09	35.3
TkA08G078280	`PF29255`	LRR_NLRC3	290	465	8.5e-11	41.9
TkA08G078280	`PF29265`	LRR_CARMIL	295	402	6.5e-06	25.8
TkA08G078280	`PF13855`	LRR_8	297	337	0.00018	21.9
TkA08G078280	`PF00560`	LRR_1	298	309	4.8e-09	35.3
TkA08G078280	`PF24048`	LRR_NXF1-5	298	337	1.1e-05	25.8
TkA08G078280	`PF13516`	LRR_6	298	308	6.2e-05	23.5
TkA08G078280	`PF12799`	LRR_4	298	308	0.0022	18.9
TkA08G078280	`PF00560`	LRR_1	327	340	4.8e-09	35.3
TkA08G078280	`PF13516`	LRR_6	327	338	6.2e-05	23.5
TkA08G078280	`PF12799`	LRR_4	327	385	0.0022	18.9
TkA08G078280	`PF29265`	LRR_CARMIL	358	579	6.5e-06	25.8
TkA08G078280	`PF13855`	LRR_8	358	405	0.00018	21.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card