TkA08G077620 | RubberDandelionOmics

Gene overview

TkA08G077620

Reference: TK1151 Chr: Chr08 Coordinates: 19896397-19897578 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1149 bp · TkA08G077620|TK1151|cDNA

ATGTCAGCAAGAACCGATATCGACAGGCTCAGCAATTTGCCGGAGGCCTTGCGGCTTCACATCCTCGGCTATCTTCACGCAAAACTGGCGGTTCAAACATCGGTATTGTCAAAAACGTGGGTTTCTTTGTGGACCGGGATCCCGGTTCTTAAAATAAACTATCTTGATTTTGGTGTCGATGAGGTAACTACGTTTGATAAGTTCGTGACCAATGTTCTATGTCGTCGTGATAGTTTGGCTAAATTGGACAGGTTAAAATT...

CDS

Download CDS FASTA

1149 bp · TkA08G077620|TK1151|CDS

ATGTCAGCAAGAACCGATATCGACAGGCTCAGCAATTTGCCGGAGGCCTTGCGGCTTCACATCCTCGGCTATCTTCACGCAAAACTGGCGGTTCAAACATCGGTATTGTCAAAAACGTGGGTTTCTTTGTGGACCGGGATCCCGGTTCTTAAAATAAACTATCTTGATTTTGGTGTCGATGAGGTAACTACGTTTGATAAGTTCGTGACCAATGTTCTATGTCGTCGTGATAGTTTGGCTAAATTGGACAGGTTAAAATT...

Protein

Download Protein FASTA

382 aa · TkA08G077620|TK1151|PROTEIN

MSARTDIDRLSNLPEALRLHILGYLHAKLAVQTSVLSKTWVSLWTGIPVLKINYLDFGVDEVTTFDKFVTNVLCRRDSLAKLDRLKFVNGTKDKLNIGFKYAFLHGVKHLEAWIQKVHVDDSETTWPVYLCDTLRSLKLQCDDGQMRFRSLVSESILFKNLKVLYLTHALITEVDPFSGFPVLKSLTLIRCNFHNERESLKVHALQLTDLTILGFNFLTSQIHKCELTAPRLRFLKYVGPFFSIGHDQGLSVLETLDIDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G077620`
TK1151 ID	TkA08G077620
OH-1004 ID	LXL04_018672
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 99.746 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G077620

Location Chr08:19896397-19897578 (+)

Description Similar to At3g58930: F-box/LRR-repeat protein At3g58930

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58930`	F-box/LRR-repeat protein At3g58930.	No verified direct reference in this release
`At3g58940`	F-box/LRR-repeat protein At3g58940.	No verified direct reference in this release
`At5g56400`	Putative FBD-associated F-box protein At5g56400.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018672 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G16930

ath:AT1G66290

ath:AT1G66310

ath:AT3G26922

ath:AT3G58930

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.816

Rank 1 · TkA08G077620 · TK1151

Cytoplasm0.252

Rank 2 · TkA08G077620 · TK1151

Cell membrane0.037

Rank 3 · TkA08G077620 · TK1151

Endoplasmic reticulum0.035

Rank 4 · TkA08G077620 · TK1151

Mitochondrion0.019

Rank 5 · TkA08G077620 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12799LRR_45-14 aa

PF00646F-box10-46 aa

PF12937F-box-like10-41 aa

PF00646F-box147-158 aa

PF12937F-box-like147-161 aa

PF13855LRR_8158-192 aa

PF12799LRR_4159-192 aa

PF12799LRR_4207-218 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G077620	`PF12799`	LRR_4	5	14	0.00071	20.5
TkA08G077620	`PF00646`	F-box	10	46	0.00031	21.3
TkA08G077620	`PF12937`	F-box-like	10	41	0.099	13.1
TkA08G077620	`PF00646`	F-box	147	158	0.00031	21.3
TkA08G077620	`PF12937`	F-box-like	147	161	0.099	13.1
TkA08G077620	`PF13855`	LRR_8	158	192	0.015	15.7
TkA08G077620	`PF12799`	LRR_4	159	192	0.00071	20.5
TkA08G077620	`PF12799`	LRR_4	207	218	0.00071	20.5
TkA08G077620	`PF12799`	LRR_4	249	258	0.00071	20.5
TkA08G077620	`PF13855`	LRR_8	249	258	0.015	15.7
TkA08G077620	`PF13855`	LRR_8	279	291	0.015	15.7
TkA08G077620	`PF12799`	LRR_4	282	291	0.00071	20.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GXW6`	Arabidopsis thaliana	sp\|Q8GXW6\|FBL59_ARATH F-box/LRR-repeat protein At3g58930	32.600%	Swiss-Prot	Medium
`Q9LXQ8`	Arabidopsis thaliana	sp\|Q9LXQ8\|FBL60_ARATH F-box/LRR-repeat protein At3g58940	30.300%	Swiss-Prot	Medium
`Q9FM91`	Arabidopsis thaliana	sp\|Q9FM91\|FBD23_ARATH Putative FBD-associated F-box protein At5g56400	24.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card