Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3264 bp · TkA08G068470|TK1151|cDNA
ATGGGAATAGAAATGGAAGGGGTGGGTGTATGTATAGTTTATAATGGCAAGGTAGGAGATGGAAAAGATGGGGGGTTAAAGAAACAAGACTCAACTACTCTCTACACAGAAGCGTTGAATTCGTGTGCACCCATCGGTTGAGAGGTGTTTGTTTCACAAACCTTTTTTTCCACCCAACCTCACATCGTTTGATTTGCTACCAGTTTGATGCAAATTCACGCATGTTTGTCGATGAAGTTGCACCCAATTTAAGCCGGAAT...
2736 bp · TkA08G068470|TK1151|CDS
ATGGAGTCTGATTCTCCGATGAGTAGCCGCTCCGATGGAAGATCCAATTACAGCCGTGTGTTTGATGATTCCAATGACGTATACGGAATTGGGGGCGCAATGCTCCCTATTTTCCTTAATGATCTACAACGCAATAATGATCAGGATTTAGTGGAAGTCACGTTGGAGTTGGAAGATGATTCGATTATCTTGTGTAGTGTCACTCCCACCGGTAACAATCCCCATACTCTTCCTGTTTCTTCACAATCGCCACCGGCCGC...
Protein
Download Protein FASTA911 aa · TkA08G068470|TK1151|PROTEIN
MESDSPMSSRSDGRSNYSRVFDDSNDVYGIGGAMLPIFLNDLQRNNDQDLVEVTLELEDDSIILCSVTPTGNNPHTLPVSSQSPPAATSRLRRKFSWLTSSSSRASSSDASVDHAIASRDARKMKAKLIRTKSSAQRALGGLRFISKTTNASDVSELWKNVESRFSYLAKDDGLLAREDFAECIGMADSKEFALGVFDALARRRQQKLGKITKAELYEFWLQISDQSFDARLQIFFDMADSNEDGRITRNEIQELLVLSA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G068470 |
|---|---|
| TK1151 ID | TkA08G068470 |
| OH-1004 ID | LXL04_018566 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.800 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G068470 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:17617190-17622869 (+) | |||||||||
| Description | Similar to RBOHE: Respiratory burst oxidase homolog protein E | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0002679 respiratory burst involved in defense response Biological Process GO:0006952 defense response Biological Process GO:0007231 osmosensory signaling pathway Biological Process GO:0009723 response to ethylene Biological Process GO:0009738 abscisic acid-activated signaling pathway Biological Process GO:0009873 ethylene-activated signaling pathway Biological Process GO:0010119 regulation of stomatal movement Biological Process GO:0033500 carbohydrate homeostasis Biological Process GO:0043069 negative regulation of programmed cell death Biological Process GO:0050665 hydrogen peroxide biosynthetic process Biological Process GO:0052542 defense response by callose deposition Biological Process GO:0072593 reactive oxygen species metabolic process Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G19230 ath:AT1G64060 dosa:Os01g0360200 sot:102579392 sot:102598898 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF08414NADPH_Ox127-230 aaPF23564EF-hand_FSTL1159-187 aaPF13405EF-hand_6165-184 aaPF13499EF-hand_7171-230 aaPF30624EF_SSP120171-192 aaPF13405EF-hand_6209-218 aaPF13202EF-hand_5209-219 aaPF00036EF-hand_1209-220 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G068470 | PF08414 | NADPH_Ox | 127 | 230 | 2.2e-38 | 131.4 |
| TkA08G068470 | PF23564 | EF-hand_FSTL1 | 159 | 187 | 0.086 | 13.9 |
| TkA08G068470 | PF13405 | EF-hand_6 | 165 | 184 | 3.5e-05 | 23.9 |
| TkA08G068470 | PF13499 | EF-hand_7 | 171 | 230 | 2e-05 | 25.5 |
| TkA08G068470 | PF30624 | EF_SSP120 | 171 | 192 | 0.007 | 17.7 |
| TkA08G068470 | PF13405 | EF-hand_6 | 209 | 218 | 3.5e-05 | 23.9 |
| TkA08G068470 | PF13202 | EF-hand_5 | 209 | 219 | 4.5e-05 | 23.5 |
| TkA08G068470 | PF00036 | EF-hand_1 | 209 | 220 | 0.00048 | 20.2 |
| TkA08G068470 | PF13833 | EF-hand_8 | 209 | 256 | 0.018 | 15.5 |
| TkA08G068470 | PF23564 | EF-hand_FSTL1 | 222 | 273 | 0.086 | 13.9 |
| TkA08G068470 | PF30624 | EF_SSP120 | 227 | 292 | 0.007 | 17.7 |
| TkA08G068470 | PF13499 | EF-hand_7 | 230 | 292 | 2e-05 | 25.5 |
| TkA08G068470 | PF13405 | EF-hand_6 | 232 | 256 | 3.5e-05 | 23.9 |
| TkA08G068470 | PF13202 | EF-hand_5 | 233 | 256 | 4.5e-05 | 23.5 |
| TkA08G068470 | PF00036 | EF-hand_1 | 233 | 256 | 0.00048 | 20.2 |
| TkA08G068470 | PF13833 | EF-hand_8 | 273 | 291 | 0.018 | 15.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.