TkA08G067900 | RubberDandelionOmics

Gene overview

TkA08G067900

Reference: TK1151 Chr: Chr08 Coordinates: 17448829-17454571 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1342 bp · TkA08G067900|TK1151|cDNA

TTAACCAAGAAATCCTTTACTATAACCTCCTGCGATCGGCGAGTCTTCTCTCCGGCAAGTAAATGGCGACCGAGCAATCGGTACTGGCGGTCATCAGGGCTTCACGACCTCAGTTTCGGAATTCTGCTGATAAAGTTGCATTCGCTATAAATTCGATCCTCCTTGCAAGTGGCTACAATCTCAACGTCACCGGCCCCCAGGCCTTCACCGACGACGCCCTTGCCACTTCCTCATCTGATGAAGTAGGAATTGAGGGTTGG...

CDS

Download CDS FASTA

1026 bp · TkA08G067900|TK1151|CDS

ATGGCGACGGAGCAATCCGTACTGGCGGTCATCAGGGCTTCACGACCTCAGTTTCGGAACTCTGCTGATAAAGTTGCATTCGCTATAAATTCGATCCTCCTTGCAAGTGGCTACAATCTCAACGTCACCGGGCCTCAGGCCTTCACCGACGACGCCCTTGCCACTTCCTCATCTGGAATTGAGGGTTGGAACGAATTCGAAAAACGTTACGCGTTTGTTTACTCAAGCCCTGAAGAGAGTTCAAAGAAAGTGCTCGTGAC...

Protein

Download Protein FASTA

341 aa · TkA08G067900|TK1151|PROTEIN

MATEQSVLAVIRASRPQFRNSADKVAFAINSILLASGYNLNVTGPQAFTDDALATSSSGIEGWNEFEKRYAFVYSSPEESSKKVLVTCLVMSNQLFVDALAAGSSNPVHLKIKIDDYVAESDDTKYSSQYKNLGKLVDTINKQVISKLNGSSTAITSNATTSSKQSVQKHLSAIYLKALDEIAFTIHSVFMRKEFSLKYTGPQAFADDALPTPLSDEEKLKGWNEVKGNYAFVYSSPERIPRDVLLKCLVINKQLFVDVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G067900`
TK1151 ID	TkA08G067900
OH-1004 ID	LXL04_018553
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.600
Protein coverage (%)	TK1151 99.707 / OH-1004 54.487 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G067900

Location Chr08:17448829-17454571 (-)

Description Similar to At3g53970: Probable proteasome inhibitor

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g53970`	Could play an important role in control of proteasome function.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018553 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process

GO:0071365 cellular response to auxin stimulus Biological Process

GO:1901799 negative regulation of proteasomal protein catabolic process Biological Process

GO:0000502 proteasome complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0048471 perinuclear region of cytoplasm Cellular Component

GO:0004866 endopeptidase inhibitor activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT3G53970

mmu:228769

rno:689852

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.673

Rank 1 · TkA08G067900 · TK1151

Nucleus0.312

Rank 2 · TkA08G067900 · TK1151

Cell membrane0.089

Rank 3 · TkA08G067900 · TK1151

Mitochondrion0.061

Rank 4 · TkA08G067900 · TK1151

Golgi apparatus0.052

Rank 5 · TkA08G067900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11566PI31_Prot_N15-150 aa

PF17939TetR_C_3046-101 aa

PF17841Bep_C_terminal62-94 aa

PF29237DUF8522105-125 aa

PF17018MICSWaP112-168 aa

PF30119DGT4124-169 aa

PF17841Bep_C_terminal141-173 aa

PF11566PI31_Prot_N178-310 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G067900	`PF11566`	PI31_Prot_N	15	150	8.7e-42	143.1
TkA08G067900	`PF17939`	TetR_C_30	46	101	0.033	15.2
TkA08G067900	`PF17841`	Bep_C_terminal	62	94	0.0093	16.9
TkA08G067900	`PF29237`	DUF8522	105	125	0.19	12.7
TkA08G067900	`PF17018`	MICSWaP	112	168	0.073	13.4
TkA08G067900	`PF30119`	DGT4	124	169	0.28	11.9
TkA08G067900	`PF17841`	Bep_C_terminal	141	173	0.0093	16.9
TkA08G067900	`PF11566`	PI31_Prot_N	178	310	8.7e-42	143.1
TkA08G067900	`PF30119`	DGT4	216	259	0.28	11.9
TkA08G067900	`PF17841`	Bep_C_terminal	221	248	0.0093	16.9
TkA08G067900	`PF29237`	DUF8522	265	282	0.19	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M330`	Arabidopsis thaliana	sp\|Q9M330\|PSMF1_ARATH Probable proteasome inhibitor	53.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card