Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1618 bp · TkA08G065070|TK1151|cDNA
TTGTGGAGAGTGCACATGAAAAAGAACAAAATGATATGCAACCATCTAGTTTGGGAGAAAATGGAAATTATCACTTTGTGATTGTTAACCCCAAGGATTCTGATGTTCAATCCAAGTCTCTTCTCCAAGAAATATTAAGCTTATACATGAAAGAACTACCATCAATGAACTATGCTGCAAATACTGGAAAGAAGTCAATGTTTCTTGATAGATGTGTATCCAACGGAAAGTATAACACCTTGGTTTTAAAATCCAAGTCA...
1551 bp · TkA08G065070|TK1151|CDS
ATGCAACCATCTAGTTTGGGAGAAAATGGAAATTATCACTTTGTGATTGTTAACCCCAAGGATTCTGATGTTCAATCCAAGTCTCTTCTCCAAGAAATATTAAGCTTATACATGAAAGAACTACCATCAATGAACTATGCTGCAAATACTGGAAAGAAGTCAATGTTTCTTGATAGATGTGTATCCAACGGAAAGTATAACACCTTGGTTTTAAAATCCAAGTCAGAAGAAGGTCTTGGAGAGGTTATTGGTGCAATTAG...
Protein
Download Protein FASTA516 aa · TkA08G065070|TK1151|PROTEIN
MQPSSLGENGNYHFVIVNPKDSDVQSKSLLQEILSLYMKELPSMNYAANTGKKSMFLDRCVSNGKYNTLVLKSKSEEGLGEVIGAISFQIISADTQYAEVPLAAVSSIHQHKGIGHLIYLEMMKRLQSVGVHSIYCWADVESEGFWVKQGFVTVGQVDTKGKAKKLQIKSDIRKALCFPGGSTLMITHLQNQDSDNPSLSLKISSLLSKSHEKSTNPSMGQSQSQHLGDENVIPGCQDLVCVDSLECINTEKSESQSQHP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G065070 |
|---|---|
| TK1151 ID | TkA08G065070 |
| OH-1004 ID | LXL04_028925 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 25.700 |
| Protein coverage (%) | TK1151 34.302 / OH-1004 21.480Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G065070 |
|---|---|
| Location | Chr08:16604229-16607166 (+) |
| Description | Similar to Paxip1: PAX-interacting protein 1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0000076 DNA replication checkpoint signaling Biological Process GO:0006281 DNA repair Biological Process GO:0006310 DNA recombination Biological Process GO:0006338 chromatin remodeling Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006974 DNA damage response Biological Process GO:0010212 response to ionizing radiation Biological Process GO:0031398 positive regulation of protein ubiquitination Biological Process GO:0043542 endothelial cell migration Biological Process GO:0060261 positive regulation of transcription initiation by RNA polymerase II Biological Process GO:1902749 regulation of cell cycle G2/M phase transition Biological Process GO:1990166 protein localization to site of double-strand break Biological Process |
| KEGG gene cross-reference | bta:513213 hsa:22976 mmu:55982 ssc:100144453 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF16589BRCT_212-27 aaPF00583Acetyltransf_167-151 aaPF13508Acetyltransf_777-152 aaPF13673Acetyltransf_1080-156 aaPF23209IDM1_C81-166 aaPF30297UMAG_00792242-328 aaPF16770RTT107_BRCT_5307-397 aaPF00533BRCT326-385 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G065070 | PF16589 | BRCT_2 | 12 | 27 | 1.8e-17 | 64.1 |
| TkA08G065070 | PF00583 | Acetyltransf_1 | 67 | 151 | 3.3e-05 | 24.9 |
| TkA08G065070 | PF13508 | Acetyltransf_7 | 77 | 152 | 0.015 | 16.4 |
| TkA08G065070 | PF13673 | Acetyltransf_10 | 80 | 156 | 0.00084 | 20.1 |
| TkA08G065070 | PF23209 | IDM1_C | 81 | 166 | 4.1e-05 | 24.4 |
| TkA08G065070 | PF30297 | UMAG_00792 | 242 | 328 | 0.29 | 12.4 |
| TkA08G065070 | PF16770 | RTT107_BRCT_5 | 307 | 397 | 2.8e-10 | 40.7 |
| TkA08G065070 | PF00533 | BRCT | 326 | 385 | 2.1e-09 | 38.1 |
| TkA08G065070 | PF16589 | BRCT_2 | 328 | 396 | 1.8e-17 | 64.1 |
| TkA08G065070 | PF18428 | BRCT_3 | 332 | 354 | 0.032 | 15.0 |
| TkA08G065070 | PF00533 | BRCT | 423 | 500 | 2.1e-09 | 38.1 |
| TkA08G065070 | PF16589 | BRCT_2 | 425 | 510 | 1.8e-17 | 64.1 |
| TkA08G065070 | PF18428 | BRCT_3 | 426 | 505 | 0.032 | 15.0 |
| TkA08G065070 | PF13673 | Acetyltransf_10 | 484 | 511 | 0.00084 | 20.1 |
| TkA08G065070 | PF16770 | RTT107_BRCT_5 | 489 | 511 | 2.8e-10 | 40.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.