RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_028925
Reference: OH-1004 Chr: Chr06 Coordinates: 74782344-74787177 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2517 bp · LXL04_028925|LXL04_028925|OH1004|cDNA

ATGGGTGGTGATGCTAAGGGTGACAGTAAATCATCCGATTCGGATAGCAGTACTTGGGATTTCGGCGGTGAGGACACTCAGATCGTCGATAGTCAGTGTTTTGATTCTCCAACATCATTGCGTGATAATAAGCTGAATGGTGATGATGCTGACAACATCCACATCTTACAAAGTACCATCCCTTTTGATGACACGGCcatttttgaagatgatttaGCCACCCAAGTGATGGATCTTGATGGTGAAACTCAAGTAGTCGA...

CDS

Download CDS FASTA

2517 bp · LXL04_028925|LXL04_028925|OH1004|CDS

ATGGGTGGTGATGCTAAGGGTGACAGTAAATCATCCGATTCGGATAGCAGTACTTGGGATTTCGGCGGTGAGGACACTCAGATCGTCGATAGTCAGTGTTTTGATTCTCCAACATCATTGCGTGATAATAAGCTGAATGGTGATGATGCTGACAACATCCACATCTTACAAAGTACCATCCCTTTTGATGACACGGCCATTTTTGAAGATGATTTAGCCACCCAAGTGATGGATCTTGATGGTGAAACTCAAGTAGTCGA...

Protein

Download Protein FASTA

838 aa · LXL04_028925|LXL04_028925|OH1004|PROTEIN

MGGDAKGDSKSSDSDSSTWDFGGEDTQIVDSQCFDSPTSLRDNKLNGDDADNIHILQSTIPFDDTAIFEDDLATQVMDLDGETQVVDLCGETQEVNFDTEVDEMDILDSIERNATQLFHDSDTEEFVTTDYEETQKIEIVDDSDDDDSNRKEHKSKIGTGLKMFTSVRAASLRASGLAARNKASQINKLTSQPEAGSSRSGFGRSTARKLFAEETPPEGNDNIDLCGTGLTYLDSQEPGESSQQNALDFVDNFLKVNTEC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_028925
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_028925
LocationChr06:74782344-74787177 (+)
DescriptionSimilar to Paxip1: PAX-interacting protein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_028925 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0000076 DNA replication checkpoint signaling Biological Process
GO:0006281 DNA repair Biological Process
GO:0006310 DNA recombination Biological Process
GO:0006338 chromatin remodeling Biological Process
GO:0006351 DNA-templated transcription Biological Process
GO:0006974 DNA damage response Biological Process
GO:0010212 response to ionizing radiation Biological Process
GO:0031398 positive regulation of protein ubiquitination Biological Process
GO:0043542 endothelial cell migration Biological Process
GO:0060261 positive regulation of transcription initiation by RNA polymerase II Biological Process
GO:1902749 regulation of cell cycle G2/M phase transition Biological Process
GO:1990166 protein localization to site of double-strand break Biological Process
KEGG gene cross-reference
bta:513213
hsa:22976
mmu:55982
ssc:100144453
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.973
Rank 1 · LXL04_028925 · OH-1004
Cytoplasm0.090
Rank 2 · LXL04_028925 · OH-1004
Cell membrane0.018
Rank 3 · LXL04_028925 · OH-1004
Endoplasmic reticulum0.009
Rank 4 · LXL04_028925 · OH-1004
Mitochondrion0.008
Rank 5 · LXL04_028925 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16770.12RTT107_BRCT_5585-678 aa
PF00533.34BRCT623-665 aa
PF16589.13BRCT_2703-791 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_028925PF16770.12RTT107_BRCT_55856784.5e-0833.6
LXL04_028925PF00533.34BRCT6236653.5e-1040.6
LXL04_028925PF16589.13BRCT_27037913.1e-1969.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser