TkA08G033470 | RubberDandelionOmics

Gene overview

TkA08G033470

Reference: TK1151 Chr: Chr08 Coordinates: 8517144-8519188 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1274 bp · TkA08G033470|TK1151|cDNA

ATTAGAAAATTTTCGAATTTGGGCCTAACTGGTTTTTAGACTGATCCGGGTATTTCGACCCGATACACGTCCATTTCACCCTAGTTCCACGGGCGAAAGGGGGAAGAAATTGGCGGGAACATATTTGTGGAATCGGTATTTATTCTTTGACAACAATCACCAGTTGATAGTTTTCATCTTATTTGGAGATTGATACTGAAAATATGAACGTAAGTCAGTTCGACGGCGCCGCCGCCTTCTCAGGCGGTGGTTTCATGCCT...

CDS

Download CDS FASTA

840 bp · TkA08G033470|TK1151|CDS

ATGAACGTAAGTCAGTTCGACGGCGCCGCCGCCTTCTCAGGCGGTGGTTTCATGCCTTCTCAGACCACTCAGACTACGGACTCTGCTCCCGCTGCGTTTTCCAAGAAAACTGATACACATACGCTGATTCCCTTGACTGTGAAGCAAATCAACAACGCGTTACTGTCGAACGATGATAAAGTGAACTTTCTCATCGATGGCGTTGACGTAAACAATGTTAAGTTGATTGGGATGATAACGAACAAAGCTGAGAGGGTTAC...

Protein

Download Protein FASTA

279 aa · TkA08G033470|TK1151|PROTEIN

MNVSQFDGAAAFSGGGFMPSQTTQTTDSAPAAFSKKTDTHTLIPLTVKQINNALLSNDDKVNFLIDGVDVNNVKLIGMITNKAERVTDVSFAIDDGTGRIDCNRWVNEPIDTKEMDALAEGTYVRVHGQLKGFQGKKQLVVFGLKPVVDFDEITHHFVECIYVHSYNTKLLKQQASTSNGNQYQVPPSSINAQAYQTAPPNQFAGQYVADGLTGVAKLVLNYLQQPASLAREGGIHQDELAQQLKIPKETIMMTIEGLVQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G033470`
TK1151 ID	TkA08G033470
OH-1004 ID	LXL04_006568
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G033470

Location Chr08:8517144-8519188 (+)

Description Similar to RPA2B: Replication protein A 32 kDa subunit B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g24490`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	ROR1/RPA2A, a putative replication protein A2, functions in epigenetic gene silencing and in regulation of meristem development in Arabidopsis.2006 · DOI: 10.1105/tpc.105.037507
`At3g02920`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0633400`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	No verified direct reference in this release
`Os02g0829100`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006568 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006260 DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0000781 chromosome, telomeric region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005662 DNA replication factor A complex Cellular Component

GO:0035861 site of double-strand break Cellular Component

GO:0003697 single-stranded DNA binding Molecular Function

GO:0042162 telomeric DNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G24490

ath:AT3G02920

dosa:Os02g0633400

dosa:Os02g0829100

dosa:Os06g0693300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.956

Rank 1 · TkA08G033470 · TK1151

Cytoplasm0.238

Rank 2 · TkA08G033470 · TK1151

Mitochondrion0.016

Rank 3 · TkA08G033470 · TK1151

Cell membrane0.014

Rank 4 · TkA08G033470 · TK1151

Endoplasmic reticulum0.008

Rank 5 · TkA08G033470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08784RPA_C38-38 aa

PF16100RMI266-144 aa

PF01336tRNA_anti-codon73-146 aa

PF08784RPA_C171-270 aa

PF01047MarR228-269 aa

PF12802MarR_2229-265 aa

PF13412HTH_24229-263 aa

PF01978TrmB229-265 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G033470	`PF08784`	RPA_C	38	38	3e-15	57.5
TkA08G033470	`PF16100`	RMI2	66	144	0.0053	17.3
TkA08G033470	`PF01336`	tRNA_anti-codon	73	146	2.5e-08	34.5
TkA08G033470	`PF08784`	RPA_C	171	270	3e-15	57.5
TkA08G033470	`PF01047`	MarR	228	269	0.03	14.9
TkA08G033470	`PF12802`	MarR_2	229	265	0.0002	22.2
TkA08G033470	`PF13412`	HTH_24	229	263	0.06	13.6
TkA08G033470	`PF01978`	TrmB	229	265	0.18	12.4
TkA08G033470	`PF25213`	HVO_A0261_N	230	277	0.35	11.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZQ19`	Arabidopsis thaliana	sp\|Q9ZQ19\|RFA2A_ARATH Replication protein A 32 kDa subunit A	42.600%	Swiss-Prot	Medium
`Q8LFJ8`	Arabidopsis thaliana	sp\|Q8LFJ8\|RFA2B_ARATH Replication protein A 32 kDa subunit B	45.600%	Swiss-Prot	Medium
`Q6H7J5`	Oryza sativa subsp. japonica	sp\|Q6H7J5\|RFA2B_ORYSJ Replication protein A 32 kDa subunit B	42.600%	Swiss-Prot	Medium
`Q6K9U2`	Oryza sativa subsp. japonica	sp\|Q6K9U2\|RFA2A_ORYSJ Replication protein A 32 kDa subunit A	37.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card