LXL04_006568 | RubberDandelionOmics

Gene overview

LXL04_006568

Reference: OH-1004 Chr: Chr02 Coordinates: 13550573-13552169 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

840 bp · LXL04_006568|LXL04_006568|OH1004|cDNA

ATGAACGTAAGTCAGTTCGACGGCGCCGCCGCCTTCTCAGGCGGTGGTTTCATGCCTTCTCAGACCACTCAGACTACGGACTCTGCTCCCGCTGCGTTTTCCAAGAAAACGGATACACATACGCTGATTCCTTTGACTGTGAAGCAAATAAACAATGCGTTACTGTCGAACGATGATAAAGTGAACTTTCTCATCGATGGCGTTGACGTAAACAATGTTAAGTTGATTGGGACGATAACGAACAAAGCTGAGAGGGTTAC...

CDS

Download CDS FASTA

840 bp · LXL04_006568|LXL04_006568|OH1004|CDS

ATGAACGTAAGTCAGTTCGACGGCGCCGCCGCCTTCTCAGGCGGTGGTTTCATGCCTTCTCAGACCACTCAGACTACGGACTCTGCTCCCGCTGCGTTTTCCAAGAAAACGGATACACATACGCTGATTCCTTTGACTGTGAAGCAAATAAACAATGCGTTACTGTCGAACGATGATAAAGTGAACTTTCTCATCGATGGCGTTGACGTAAACAATGTTAAGTTGATTGGGACGATAACGAACAAAGCTGAGAGGGTTAC...

Protein

Download Protein FASTA

279 aa · LXL04_006568|LXL04_006568|OH1004|PROTEIN

MNVSQFDGAAAFSGGGFMPSQTTQTTDSAPAAFSKKTDTHTLIPLTVKQINNALLSNDDKVNFLIDGVDVNNVKLIGTITNKAERVTDVSFAIDDGTGRIDCNRWMNEPIDTKEMDALAEGTYVRVHGQLKGFQGKKQLVVFGIKPVVDFDEITHHFVECIYVHSYNTKLLKQQASTSNGNQYQVPPSSINAQAYQTAPPNQFAGQYVADGLTGVDKLVLNYLQQPASLAREGGIHQDELAQQLKIPKETIMMAIEGLVQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_006568`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_006568

Location Chr02:13550573-13552169 (+)

Description Similar to RPA2B: Replication protein A 32 kDa subunit B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g02920`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	No verified direct reference in this release
`At2g24490`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	ROR1/RPA2A, a putative replication protein A2, functions in epigenetic gene silencing and in regulation of meristem development in Arabidopsis.2006 · DOI: 10.1105/tpc.105.037507

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0633400`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	No verified direct reference in this release
`Os02g0829100`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	No verified direct reference in this release
`Os06g0693300`	Component of the replication protein A complex (RPA) required for DNA recombination, repair and replication.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006568 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006260 DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006289 nucleotide-excision repair Biological Process

GO:0000781 chromosome, telomeric region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005662 DNA replication factor A complex Cellular Component

GO:0035861 site of double-strand break Cellular Component

GO:0003697 single-stranded DNA binding Molecular Function

GO:0042162 telomeric DNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G24490

ath:AT3G02920

dosa:Os02g0633400

dosa:Os02g0829100

dosa:Os06g0693300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.956

Rank 1 · LXL04_006568 · OH-1004

Cytoplasm0.237

Rank 2 · LXL04_006568 · OH-1004

Mitochondrion0.016

Rank 3 · LXL04_006568 · OH-1004

Cell membrane0.014

Rank 4 · LXL04_006568 · OH-1004

Endoplasmic reticulum0.008

Rank 5 · LXL04_006568 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01336.32tRNA_anti-codon73-146 aa

PF08784.18RPA_C171-270 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_006568	`PF01336.32`	tRNA_anti-codon	73	146	4e-08	33.8
LXL04_006568	`PF08784.18`	RPA_C	171	270	1.5e-15	58.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LFJ8`	Arabidopsis thaliana	Replication protein A 32 kDa subunit B	47.687%	Swiss-Prot	moderate database homology
`Q9ZQ19`	Arabidopsis thaliana	Replication protein A 32 kDa subunit A	42.647%	Swiss-Prot	moderate database homology
`Q6H7J5`	Oryza sativa subsp. japonica	Replication protein A 32 kDa subunit B	42.294%	Swiss-Prot	moderate database homology
`Q6K9U2`	Oryza sativa subsp. japonica	Replication protein A 32 kDa subunit A	37.457%	Swiss-Prot	moderate database homology
`Q5Z8L1`	Oryza sativa subsp. japonica	Replication protein A 32 kDa subunit C	33.962%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card