TkA08G026380 | RubberDandelionOmics

Gene overview

TkA08G026380

Reference: TK1151 Chr: Chr08 Coordinates: 6796711-6802930 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2226 bp · TkA08G026380|TK1151|cDNA

CCCATGAATTTCTAAGTCCTTCTAGAAATTCCAGAATCACCGGTACCTCCATCGGTAATAATCATAACTCGATCATCACCTAGTCTCGGATTCTGAATCAGACATCACTCGCCTGAATCAATCTTCGTATTGATGCTACACCACCAACCACGATTCCGGACCTTCTGTATCATTTTTTTTTCTCTTTTTTTTTTTCACAAAATTAATTACATTTTAAAATAAAAAAAAACAATTTACAAATTGGGCTTGGGCTAAAACTG...

CDS

Download CDS FASTA

1074 bp · TkA08G026380|TK1151|CDS

ATGGAAGCTGCCGCCAAAACTACGCCATGGTTCTCCTTGCCTTGGAAAAGACGCATTTTGTTTTCGGTAGTCTCCACCGCAATTGCAGTAGTTAGCCGGAGAGACGGCACCGTAAATCGGCGTCTCGTCAAATTCCTAGACTTCCGGACCCCGCCGACAACTAAACCGATCAACGGTGTCAAGACATACGACATCGTCGTAGATTCCTCTCGCAAGCTCTGGTTCCGAGTATTCGTGCCTGTACAACATGCAGTAGAACA...

Protein

Download Protein FASTA

357 aa · TkA08G026380|TK1151|PROTEIN

MEAAAKTTPWFSLPWKRRILFSVVSTAIAVVSRRDGTVNRRLVKFLDFRTPPTTKPINGVKTYDIVVDSSRKLWFRVFVPVQHAVEHLPVLVFFHGGGFVYLAPDKDIYDAFCRRIARKLPAIVVSVNYRLAPEHRYPEQHDDCFDVLKFLDDEENCLESLPEKTNISRCFLAGDSAGGNLVHHVAQRACEFNFQRLKVTGMLSIQPFFGGEERTNSEKLFEGRTPLASLKQTDWYWNAIMPPGESNNRDHPIINVSGPM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G026380`
TK1151 ID	TkA08G026380
OH-1004 ID	LXL04_018109
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.400
Protein coverage (%)	TK1151 94.678 / OH-1004 75.278 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G026380

Location Chr08:6796711-6802930 (+)

Description Similar to CXE18: Probable carboxylesterase 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23530`	Carboxylesterase acting on esters with varying acyl chain length.	No verified direct reference in this release
`At5g27320`	Functions as a soluble gibberellin (GA) receptor.	Identification and characterization of Arabidopsis gibberellin receptors.2006 · DOI: 10.1111/j.1365-313x.2006.02748.x Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis.2006 · DOI: 10.1105/tpc.106.047415 Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal.2007 · DOI: 10.1111/j.1365-313x.2007.03098.x
`At3g63010`	Functions as a soluble gibberellin (GA) receptor.	Identification and characterization of Arabidopsis gibberellin receptors.2006 · DOI: 10.1111/j.1365-313x.2006.02748.x Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis.2006 · DOI: 10.1105/tpc.106.047415 Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal.2007 · DOI: 10.1111/j.1365-313x.2007.03098.x
`At3g05120`	Functions as a soluble gibberellin (GA) receptor.	Identification and characterization of Arabidopsis gibberellin receptors.2006 · DOI: 10.1111/j.1365-313x.2006.02748.x Genetic characterization and functional analysis of the GID1 gibberellin receptors in Arabidopsis.2006 · DOI: 10.1105/tpc.106.047415 Multiple loss-of-function of Arabidopsis gibberellin receptor AtGID1s completely shuts down a gibberellin signal.2007 · DOI: 10.1111/j.1365-313x.2007.03098.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0407500`	Functions as a soluble gibberellin (GA) receptor.	GIBBERELLIN INSENSITIVE DWARF1 encodes a soluble receptor for gibberellin.2005 · DOI: 10.1038/nature04028

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018109 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009739 response to gibberellin Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0009939 positive regulation of gibberellic acid mediated signaling pathway Biological Process

GO:0010476 gibberellin mediated signaling pathway Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0048444 floral organ morphogenesis Biological Process

GO:0048530 fruit morphogenesis Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:1905516 positive regulation of fertilization Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT3G05120

ath:AT3G63010

ath:AT5G23530

ath:AT5G27320

dosa:Os05g0407500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.459

Rank 1 · TkA08G026380 · TK1151

Endoplasmic reticulum0.248

Rank 2 · TkA08G026380 · TK1151

Nucleus0.165

Rank 3 · TkA08G026380 · TK1151

Cell membrane0.092

Rank 4 · TkA08G026380 · TK1151

Lysosome / Vacuole0.077

Rank 5 · TkA08G026380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10340Say1_Mug18069-184 aa

PF00135COesterase74-132 aa

PF20434BD-FAE80-186 aa

PF07224Chlorophyllase86-214 aa

PF07859Abhydrolase_391-313 aa

PF12146Hydrolase_4149-214 aa

PF00135COesterase171-185 aa

PF10340Say1_Mug180213-254 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G026380	`PF10340`	Say1_Mug180	69	184	4.5e-07	29.8
TkA08G026380	`PF00135`	COesterase	74	132	1.1e-07	31.9
TkA08G026380	`PF20434`	BD-FAE	80	186	2.7e-10	40.9
TkA08G026380	`PF07224`	Chlorophyllase	86	214	0.0028	17.2
TkA08G026380	`PF07859`	Abhydrolase_3	91	313	2.2e-59	201.5
TkA08G026380	`PF12146`	Hydrolase_4	149	214	0.042	13.9
TkA08G026380	`PF00135`	COesterase	171	185	1.1e-07	31.9
TkA08G026380	`PF10340`	Say1_Mug180	213	254	4.5e-07	29.8
TkA08G026380	`PF12146`	Hydrolase_4	272	304	0.042	13.9
TkA08G026380	`PF07442`	Ponericin	284	297	0.24	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LT10`	Arabidopsis thaliana	sp\|Q9LT10\|CXE18_ARATH Probable carboxylesterase 18	56.500%	Swiss-Prot	High
`Q940G6`	Arabidopsis thaliana	sp\|Q940G6\|GID1C_ARATH Gibberellin receptor GID1C	39.800%	Swiss-Prot	Medium
`Q9LYC1`	Arabidopsis thaliana	sp\|Q9LYC1\|GID1B_ARATH Gibberellin receptor GID1B	36.900%	Swiss-Prot	Medium
`Q9MAA7`	Arabidopsis thaliana	sp\|Q9MAA7\|GID1A_ARATH Gibberellin receptor GID1A	35.100%	Swiss-Prot	Medium
`Q6L545`	Oryza sativa subsp. japonica	sp\|Q6L545\|GID1_ORYSJ Gibberellin receptor GID1	34.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card