Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2346 bp · TkA08G025510|TK1151|cDNA
ACCATACAAAATCTCAAAAGATCCCCGTAAATAATAAAGAAATGAGCAAAAGGAAAACCAAAGGCGACTAATCCTTCATAATACGAGTGAATCATCGCTCTGATGACTTGTACCATCTTAACAAAATGTTGTGCGATCTTTATCAATCTGACAGTTTGAGCTTTGTCAGAAGCTATAAGCCCTCTCCTTGTCCCCTGTTATTCACGTCATTCGCTTTCTTTTCTTTCACTCGCACATAAAAAGGGATCCCAATGCTTCAT...
1845 bp · TkA08G025510|TK1151|CDS
ATGGATTCGGATAGAAAGAGGCTGTCAACGGATTCATTAAAAAATGGGGTGGTGATGGGTTCTGTTTGGGAGAGCAGAATGAAAGGTAGCTTCAAAGTCTTCAATGGTGGTGATGGCAAGAACCAAGAAATTGGGAAACCGACAGACAAAAACAACCAAACTGAGACTACTGGTGAGATTGTTAAAATGGAGAAGGCGGTTTTGAGATCCAAACCGAGCTCTAATGGCGTCGGTGGTGGTGGAAAGAGGAAAACATGGAA...
Protein
Download Protein FASTA614 aa · TkA08G025510|TK1151|PROTEIN
MDSDRKRLSTDSLKNGVVMGSVWESRMKGSFKVFNGGDGKNQEIGKPTDKNNQTETTGEIVKMEKAVLRSKPSSNGVGGGGKRKTWKSDCNFEGTEKIPAQISKARSENKKVLGELSKELSDSVEGNGIKKSPAQMKKGRLACGKEQSGSIDGIERSPVQRTIATRSLSRKGSTSSDLVINSNMDLTKVKSLSTKGNRITDEPNNGAEEIKGENRDANAIEKKISDSSQNLEELEVVCEEKLMTDDSGKVKSPRSLSTED...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA08G025510 |
|---|---|
| TK1151 ID | TkA08G025510 |
| OH-1004 ID | LXL04_018134 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 94.800 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA08G025510 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:6444363-6447762 (-) | |||||||||
| Description | Similar to RTNLB21: Reticulon-like protein B21 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0007029 endoplasmic reticulum organization Biological Process GO:0010634 positive regulation of epithelial cell migration Biological Process GO:0030308 negative regulation of cell growth Biological Process GO:0030334 regulation of cell migration Biological Process GO:0033603 positive regulation of dopamine secretion Biological Process GO:0034165 positive regulation of toll-like receptor 9 signaling pathway Biological Process GO:0035022 positive regulation of Rac protein signal transduction Biological Process GO:0050821 protein stabilization Biological Process GO:0051292 nuclear pore complex assembly Biological Process GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction Biological Process GO:0060907 positive regulation of macrophage cytokine production Biological Process GO:0061462 protein localization to lysosome Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT2G20590 ath:AT4G28430 ath:AT5G58000 hsa:57142 mmu:68585 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02453Reticulon362-517 aaPF02453Reticulon539-566 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA08G025510 | PF02453 | Reticulon | 362 | 517 | 1.5e-23 | 84.2 |
| TkA08G025510 | PF02453 | Reticulon | 539 | 566 | 1.5e-23 | 84.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.