LXL04_018134 | RubberDandelionOmics

Gene overview

LXL04_018134

Reference: OH-1004 Chr: Chr04 Coordinates: 7161688-7164657 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1845 bp · LXL04_018134|LXL04_018134|OH1004|cDNA

ATGGATTCGGATAGAAAGAGGCTGTCAACGGATTCATTAAAAAATGGGGTGGTGATGGGTTCTGTTTGGGAGAGCAGAATGAAAGGTAGCTTCAAAGTCTTCAATGGTGGTGATGGCAAGAACCAAGAAATTGGGAAACCGACAGACAAAAACAACCAAACTGAGACTACTGGTGAGATTGTTAAAATGGAGAAGGCGGTTTTGAGATCCAAACCGAGCTCTAATGGCGTCGGTGGTGGTGGAAAGAGGAAAACATGGAA...

CDS

Download CDS FASTA

1845 bp · LXL04_018134|LXL04_018134|OH1004|CDS

ATGGATTCGGATAGAAAGAGGCTGTCAACGGATTCATTAAAAAATGGGGTGGTGATGGGTTCTGTTTGGGAGAGCAGAATGAAAGGTAGCTTCAAAGTCTTCAATGGTGGTGATGGCAAGAACCAAGAAATTGGGAAACCGACAGACAAAAACAACCAAACTGAGACTACTGGTGAGATTGTTAAAATGGAGAAGGCGGTTTTGAGATCCAAACCGAGCTCTAATGGCGTCGGTGGTGGTGGAAAGAGGAAAACATGGAA...

Protein

Download Protein FASTA

614 aa · LXL04_018134|LXL04_018134|OH1004|PROTEIN

MDSDRKRLSTDSLKNGVVMGSVWESRMKGSFKVFNGGDGKNQEIGKPTDKNNQTETTGEIVKMEKAVLRSKPSSNGVGGGGKRKTWKSDCNFEGTEKIPAQISKARSENKKVLGELSKELSDSVEGNGIKKSPAQMKKGRLACGKEQSGSIDGIERSPVQRTIATRSLSRKGSTSSDLVINSNMDLTKVKSLSTKGNRITDESNNGVEEVKGENRDANAIEKKISDSSQNLEELEVVCEEKLMTDDSGKVKPPRSLSTED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018134`
TK1151 ID	TkA08G025510
OH-1004 ID	LXL04_018134
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018134

Location Chr04:7161688-7164657 (+)

Description Similar to RTNLB21: Reticulon-like protein B21

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58000`	Reticulon-like protein B21.	No verified direct reference in this release
`At2g20590`	Reticulon-like protein B17.	No verified direct reference in this release
`At4g28430`	Reticulon-like protein B18.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018134 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007029 endoplasmic reticulum organization Biological Process

GO:0010634 positive regulation of epithelial cell migration Biological Process

GO:0030308 negative regulation of cell growth Biological Process

GO:0030334 regulation of cell migration Biological Process

GO:0033603 positive regulation of dopamine secretion Biological Process

GO:0034165 positive regulation of toll-like receptor 9 signaling pathway Biological Process

GO:0035022 positive regulation of Rac protein signal transduction Biological Process

GO:0050821 protein stabilization Biological Process

GO:0051292 nuclear pore complex assembly Biological Process

GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction Biological Process

GO:0060907 positive regulation of macrophage cytokine production Biological Process

GO:0061462 protein localization to lysosome Biological Process

KEGG gene cross-reference

ath:AT2G20590

ath:AT4G28430

ath:AT5G58000

hsa:57142

mmu:68585

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.288

Rank 1 · LXL04_018134 · OH-1004

Nucleus0.269

Rank 2 · LXL04_018134 · OH-1004

Cell membrane0.239

Rank 3 · LXL04_018134 · OH-1004

Cytoplasm0.151

Rank 4 · LXL04_018134 · OH-1004

Plastid0.147

Rank 5 · LXL04_018134 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02453.24Reticulon362-517 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018134	`PF02453.24`	Reticulon	362	517	2.9e-22	80.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q56X72`	Arabidopsis thaliana	Reticulon-like protein B21	51.601%	Swiss-Prot	weak database homology
`Q6DR04`	Arabidopsis thaliana	Reticulon-like protein B17	39.151%	Swiss-Prot	weak database homology
`Q8LDS3`	Arabidopsis thaliana	Reticulon-like protein B18	38.532%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card