TkA07G444270 | RubberDandelionOmics

Gene overview

TkA07G444270

Reference: TK1151 Chr: Chr07 Coordinates: 112713743-112716317 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1828 bp · TkA07G444270|TK1151|cDNA

AGGAACTGCTATACAAAACCATAACACCAACAAACATCATCAAATAATCATCAAAATCCTTTTCAATTTCTGTTATAAATTTCCAGAATTTCTGAAATCTCAATCAACAAGGAAATGGCGAAAGAGGAGACGTATATTGGATCGATAGATCAAGGAACAACAAGCACAAGATTCATCATTTACAACAAGAAAGCTGAAATCATCGGATCCCACCAAGTCGAGTTCACTCAATTCTGCCCACAAGCAGGATGGGTGGAGCA...

CDS

Download CDS FASTA

1569 bp · TkA07G444270|TK1151|CDS

ATGGCGAAAGAGGAGACGTATATTGGATCGATAGATCAAGGAACAACAAGCACAAGATTCATCATTTACAACAAGAAAGCTGAAATCATCGGATCCCACCAAGTCGAGTTCACTCAATTCTGCCCACAAGCAGGATGGGTGGAGCATGATCCTATGGAGATTCTCGAAAGTGTGAGAATATGCGTATCAAAGACAATCGATAAAGCCACTGCCGATGGATTCAACATTGACAATGGCCTTAAAGCAATCGGAATTACAAA...

Protein

Download Protein FASTA

522 aa · TkA07G444270|TK1151|PROTEIN

MAKEETYIGSIDQGTTSTRFIIYNKKAEIIGSHQVEFTQFCPQAGWVEHDPMEILESVRICVSKTIDKATADGFNIDNGLKAIGITNQRETTVVWSKSTGIPLCNAIVWMDIRTSSICSELEKKLSGGRTHFLETCGLPISTYFSAMKLLWLLQNVKKVKEVVDKGDALFGTIDSWLIWSLTGGINNGVHVTDVSNASRTMLMNIKTLNWDKPTLETLKIPSGILPKIISNSEIIGRVGKGWPFTGVPISGCLGDQHAAM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G444270`
TK1151 ID	TkA07G444270
OH-1004 ID	LXL04_030997
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G444270

Location Chr07:112713743-112716317 (-)

Description Similar to GLPK: Glycerol kinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g80460`	Key enzyme in the regulation of glycerol uptake and metabolism.	Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.2001 · DOI: 10.1105/tpc.13.2.437 Interplay of the Arabidopsis nonhost resistance gene NHO1 with bacterial virulence.2003 · DOI: 10.1073/pnas.0637377100 Glycerol-insensitive Arabidopsis mutants: gli1 seedlings lack glycerol kinase, accumulate glycerol and are more resistant to abiotic stress.2004 · DOI: 10.1111/j.1365-313x.2003.01989.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030997 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002237 response to molecule of bacterial origin Biological Process

GO:0006071 glycerol metabolic process Biological Process

GO:0006641 triglyceride metabolic process Biological Process

GO:0009410 response to xenobiotic stimulus Biological Process

GO:0009617 response to bacterium Biological Process

GO:0010188 response to microbial phytotoxin Biological Process

GO:0019217 regulation of fatty acid metabolic process Biological Process

GO:0019432 triglyceride biosynthetic process Biological Process

GO:0019563 glycerol catabolic process Biological Process

GO:0042593 glucose homeostasis Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045471 response to ethanol Biological Process

KEGG gene cross-reference

ath:AT1G80460

hsa:2710

hsa:2713

mmu:14933

rno:79223

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.683

Rank 1 · TkA07G444270 · TK1151

Nucleus0.223

Rank 2 · TkA07G444270 · TK1151

Peroxisome0.099

Rank 3 · TkA07G444270 · TK1151

Mitochondrion0.097

Rank 4 · TkA07G444270 · TK1151

Cell membrane0.043

Rank 5 · TkA07G444270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00370FGGY_N7-262 aa

PF02782FGGY_C270-469 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G444270	`PF00370`	FGGY_N	7	262	3.2e-70	237.2
TkA07G444270	`PF02782`	FGGY_C	270	469	1.1e-46	160.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M8L4`	Arabidopsis thaliana	sp\|Q9M8L4\|GLPK_ARATH Glycerol kinase	75.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card