RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G438670
Reference: TK1151 Chr: Chr07 Coordinates: 111074295-111082880 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1981 bp · TkA07G438670|TK1151|cDNA

AGCAGACCACTCGCTCAATAACTCTCATAGAATCAATAGTTACTTCGTTCCACGGTTTTCATTCAAGCTTCAGAGCATCATACCCGCTTCTAAATCAATATCAAAACCATAGAAATCGAAGCCAAAAACAGAATTCGGCTGCAGTTTCTCGATGAAAAGTCAACTCCCGAAGTAGCTGCTACCCAATTTCTAGAACTTGAAATCACGATGCAGAACTATTACCAGACTCCTACCGACAACATGAATCAGAATCTATACTC...

CDS

Download CDS FASTA

1110 bp · TkA07G438670|TK1151|CDS

ATGGCAATTCAACATGGGGTTATAGTAAAAATGGAAACCGATTTCGGTAAACTGTTCATCGGTGGGATTTCATGGGACACCGATGAAGCTCGATTGAAAGAGTATTTCAGTAGTTACGGTGAAGTTATCGAAGCCGTGATCATGAGAGATCGAATCACCGGTCGTGCTCGTGGATTTGGATTCATCGTCTTCGCTGATCCCGCTGTTGCAGAAAGAGTCGTAATGGAGAAACACATGATCGATGGTCGAACCGTGGAAGC...

Protein

Download Protein FASTA

369 aa · TkA07G438670|TK1151|PROTEIN

MAIQHGVIVKMETDFGKLFIGGISWDTDEARLKEYFSSYGEVIEAVIMRDRITGRARGFGFIVFADPAVAERVVMEKHMIDGRTVEAKKAVPREDHHGLNRINNNNNNNNGNSIQGSPGPGGRTKKIFVGGLASTVTESDFKKYFDQFGTITDVVVMYDHNTQRPRGFGFITFDSEESVDRVLHKTFHELNGKMVEVKRAVPKELSPGPSRSPLVGYNYGLTRPNTFLTSSYPQGYNMGSIYGGRTDTRFSPIAATGRTG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G438670
TK1151 IDTkA07G438670
OH-1004 IDLXL04_030888
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)98.600
Protein coverage (%)TK1151 98.374 / OH-1004 79.605
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G438670
LocationChr07:111074295-111082880 (+)
DescriptionSimilar to RNP1: Heterogeneous nuclear ribonucleoprotein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g48150 Probable transcription factor involved in phytochrome A (phyA) signal transduction. No verified direct reference in this release
At1g50600 Probable transcription factor involved in plant development. No verified direct reference in this release
At4g17230 Probable transcription factor that acts as a positive regulator of continuous red light signals downstream of phytochrome B (phyB).
The GRAS protein SCL13 is a positive regulator of phytochrome-dependent red light signaling, but can also modulate phytochrome A responses.2006 · DOI: 10.1007/s00438-006-0123-y
At2g04890 Probable transcription factor involved in plant development. No verified direct reference in this release
At4g14300 Involved with pre-mRNA processing. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os07g0583600 May play a regulatory role in the early step of oligosaccharide elicitor response, downstream of the membrane- associated high-affinity chitin-binding protein.
Identification and characterization of two new members of the GRAS gene family in rice responsive to N-acetylchitooligosaccharide elicitor.2003 · DOI: 10.1016/s0167-4781(02)00626-7
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_030888 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006397 mRNA processing Biological Process
GO:0006417 regulation of translation Biological Process
GO:0008380 RNA splicing Biological Process
GO:0010228 vegetative to reproductive phase transition of meristem Biological Process
GO:0048864 stem cell development Biological Process
GO:0051028 mRNA transport Biological Process
GO:1901000 regulation of response to salt stress Biological Process
GO:2000070 regulation of response to water deprivation Biological Process
GO:0005634 nucleus Cellular Component
GO:0005681 spliceosomal complex Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
KEGG gene cross-reference
ath:AT1G58470
ath:AT4G14300
dme:Dmel_CG32169
mmu:76626
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.646
Rank 1 · TkA07G438670 · TK1151
Nucleus0.460
Rank 2 · TkA07G438670 · TK1151
Cell membrane0.066
Rank 3 · TkA07G438670 · TK1151
Endoplasmic reticulum0.043
Rank 4 · TkA07G438670 · TK1151
Mitochondrion0.037
Rank 5 · TkA07G438670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16367RRM_717-72 aa
PF00076RRM_118-84 aa
PF28441RRM_1122-92 aa
PF29093MRX12_C23-45 aa
PF23085RRM_PARP14_324-86 aa
PF21569SET1_RBD28-42 aa
PF14605Nup35_RRM_234-45 aa
PF23222RRM_PARP14_153-80 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G438670PF16367RRM_717722.2e-1557.1
TkA07G438670PF00076RRM_118843.9e-34117.1
TkA07G438670PF28441RRM_1122926.5e-0627.1
TkA07G438670PF29093MRX12_C23450.212.5
TkA07G438670PF23085RRM_PARP14_324865.7e-0936.7
TkA07G438670PF21569SET1_RBD28420.1213.3
TkA07G438670PF14605Nup35_RRM_234450.1612.6
TkA07G438670PF23222RRM_PARP14_153800.05914.0
TkA07G438670PF14703PHM7_cyt881840.1513.0
TkA07G438670PF23085RRM_PARP14_31241985.7e-0936.7
TkA07G438670PF16367RRM_71251962.2e-1557.1
TkA07G438670PF00076RRM_11271853.9e-34117.1
TkA07G438670PF28441RRM_111312056.5e-0627.1
TkA07G438670PF21569SET1_RBD1341760.1213.3
TkA07G438670PF29093MRX12_C1361530.212.5
TkA07G438670PF14605Nup35_RRM_21381770.1612.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LDL7Arabidopsis thalianasp|Q9LDL7|PAT1_ARATH Scarecrow-like transcription factor PAT168.100%Swiss-ProtHigh
Q8H125Arabidopsis thalianasp|Q8H125|SCL5_ARATH Scarecrow-like protein 561.900%Swiss-ProtHigh
Q9M0M5Arabidopsis thalianasp|Q9M0M5|SCL13_ARATH Scarecrow-like protein 1360.200%Swiss-ProtHigh
Q9S7H5Arabidopsis thalianasp|Q9S7H5|SCL21_ARATH Scarecrow-like protein 2159.100%Swiss-ProtHigh
Q8W034Arabidopsis thalianasp|Q8W034|RNP1_ARATH Heterogeneous nuclear ribonucleoprotein 145.500%Swiss-ProtMedium
Q8GVE1Oryza sativa subsp. japonicasp|Q8GVE1|CIGR2_ORYSJ Chitin-inducible gibberellin-responsive protein 265.800%Swiss-ProtHigh

JBrowse

View in Genome Browser