TkA07G437000 | RubberDandelionOmics

Gene overview

TkA07G437000

Reference: TK1151 Chr: Chr07 Coordinates: 110617624-110623335 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2169 bp · TkA07G437000|TK1151|cDNA

ATACCCCTTTCTCTCTGTCAACTCTTCGCAATTTCAATTCAATTTCCTGCTCCGTCTACTACCACTACTCTTTCATCCCGCCGGCGTTCCATGGGCAATTGCTTCTCCGGCGGAGGCCATACTCAATTTGCCGTTGGAGGCACGTCCTCTGCTCTTGATACTCGTGGCTCTAACGACGCCGTAGACAGCTTTCTAAATTTTCGCGGCTACAATGGCCTCTTCTCTCAGATCGAGCTATCCTTATCTGCTTCAGACTTGCG...

CDS

Download CDS FASTA

1770 bp · TkA07G437000|TK1151|CDS

ATGGGCAATTGCTTCTCCGGCGGAGGCCATACTCAATTTGCCGTTGGAGGCACGTCCTCTGCTCTTGATACTCGTGGCTCTAACGACGCCGTAGACAGCTTTCTAAATTTTCGCGGCTACAATGGCCTCTTCTCTCAGATCGAGCTATCCTTATCTGCTTCAGACTTGCGTGACAGGGATGTGCTTTCCAAAAGTGATCCTATGGCAGTTGTATATACCAAAGGAAAAGATGGACAACTGCAGGAGCTTGGCCGCACAGA...

Protein

Download Protein FASTA

589 aa · TkA07G437000|TK1151|PROTEIN

MGNCFSGGGHTQFAVGGTSSALDTRGSNDAVDSFLNFRGYNGLFSQIELSLSASDLRDRDVLSKSDPMAVVYTKGKDGQLQELGRTEVVINSLNPKWITKIKITYYFEMVQTLLFRVYDVDTQLHNPEIKTLKLDDQQYLGEATCALSQIVANSKRACTLDLVSIAESTESTRKNLGQITVHAEEEVVSKTTAELILKCTDLENKDFFSKSDPFLVISKYTESGTTVPICRTEVLKNNLKPVWKPIFLNISQVGSKDSPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G437000`
TK1151 ID	TkA07G437000
OH-1004 ID	LXL04_030848
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.132 / OH-1004 98.132 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G437000

Location Chr07:110617624-110623335 (-)

Description Similar to BON1: Protein BONZAI 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61900`	Negative regulator of cell death and defense responses.	A haplotype-specific Resistance gene regulated by BONZAI1 mediates temperature-dependent growth control in Arabidopsis.2004 · DOI: 10.1105/tpc.020479 The BON/CPN gene family represses cell death and promotes cell growth in Arabidopsis.2006 · DOI: 10.1111/j.1365-313x.2005.02585.x Evidence that the BONZAI1/COPINE1 protein is a calcium- and pathogen-responsive defense suppressor.2009 · DOI: 10.1007/s11103-008-9413-6 Multiple R-like genes are negatively regulated by BON1 and BON3 in arabidopsis.2009 · DOI: 10.1094/mpmi-22-7-0840 Requirement of calcium binding, myristoylation, and protein-protein interaction for the Copine BON1 function in Arabidopsis.2010 · DOI: 10.1074/jbc.m109.066100
`At5g07300`	Negative regulator of cell death and defense responses.	The BON/CPN gene family represses cell death and promotes cell growth in Arabidopsis.2006 · DOI: 10.1111/j.1365-313x.2005.02585.x
`At1g08860`	Negative regulator of cell death and defense responses.	The BON/CPN gene family represses cell death and promotes cell growth in Arabidopsis.2006 · DOI: 10.1111/j.1365-313x.2005.02585.x Multiple R-like genes are negatively regulated by BON1 and BON3 in arabidopsis.2009 · DOI: 10.1094/mpmi-22-7-0840

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030848 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006508 proteolysis Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0006952 defense response Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009270 response to humidity Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0019725 cellular homeostasis Biological Process

GO:0030335 positive regulation of cell migration Biological Process

GO:0038128 ERBB2 signaling pathway Biological Process

GO:0043069 negative regulation of programmed cell death Biological Process

KEGG gene cross-reference

ath:AT1G08860

ath:AT5G07300

ath:AT5G61900

hsa:8895

hsa:8904

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.486

Rank 1 · TkA07G437000 · TK1151

Cell membrane0.337

Rank 2 · TkA07G437000 · TK1151

Nucleus0.213

Rank 3 · TkA07G437000 · TK1151

Golgi apparatus0.120

Rank 4 · TkA07G437000 · TK1151

Endoplasmic reticulum0.119

Rank 5 · TkA07G437000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00168C251-156 aa

PF16183Kinesin_assoc51-109 aa

PF16183Kinesin_assoc168-176 aa

PF00168C2196-290 aa

PF07002Copine361-576 aa

PF10138vWA-TerF-like361-384 aa

PF00092VWA434-523 aa

PF10138vWA-TerF-like461-524 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G437000	`PF00168`	C2	51	156	1.8e-27	96.3
TkA07G437000	`PF16183`	Kinesin_assoc	51	109	0.11	13.4
TkA07G437000	`PF16183`	Kinesin_assoc	168	176	0.11	13.4
TkA07G437000	`PF00168`	C2	196	290	1.8e-27	96.3
TkA07G437000	`PF07002`	Copine	361	576	2.4e-78	263.3
TkA07G437000	`PF10138`	vWA-TerF-like	361	384	0.0003	21.8
TkA07G437000	`PF00092`	VWA	434	523	0.0077	17.2
TkA07G437000	`PF10138`	vWA-TerF-like	461	524	0.0003	21.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q941L3`	Arabidopsis thaliana	sp\|Q941L3\|BON1_ARATH Protein BONZAI 1	66.100%	Swiss-Prot	High
`Q5S1W2`	Arabidopsis thaliana	sp\|Q5S1W2\|BON2_ARATH Protein BONZAI 2	66.200%	Swiss-Prot	High
`Q5XQC7`	Arabidopsis thaliana	sp\|Q5XQC7\|BON3_ARATH Protein BONZAI 3	57.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card