TkA07G435200 | RubberDandelionOmics

Gene overview

TkA07G435200

Reference: TK1151 Chr: Chr07 Coordinates: 110156575-110161154 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1584 bp · TkA07G435200|TK1151|cDNA

TCCGAATTAGGATCCGACAAACAACTGCCAGCTGGAGAGAGAGGAGAGATCTCGTTAATTTTCCCCCTTTTGATTCTCTGTTGCAAACCATAATTCAATTCAACAATCGGGAACCTCCGTTGTTGTTGATCTCAAGGATTTTGAGCAACAATGGCCACCAGATACTGGATAGTTTCTCTTCCCGTTAAGAGCTCTGCTTCTTCTCTATGGAGCCGCTTACAAGAATCCATCTCCAAAAACTCATTCGACACTCCTCTCTA...

CDS

Download CDS FASTA

1125 bp · TkA07G435200|TK1151|CDS

ATGGCCACCAGATACTGGATAGTTTCTCTTCCCGTTAAGAGCTCTGCTTCTTCTCTATGGAGCCGCTTACAAGAATCCATCTCCAAAAACTCATTCGACACTCCTCTCTACAGGTTTAATATCCCGAATCTTCGTGTTGGCACTCTGGATTCGCTTTTAGCCCTCAGCGATGACTTGCTCAAGGCGAATACGTTCATCGAAGCATGCTCTCACAAGATACGGCGTCAGATTGAAGATTTGGAAAAGTTATCGGGAATTCT...

Protein

Download Protein FASTA

374 aa · TkA07G435200|TK1151|PROTEIN

MATRYWIVSLPVKSSASSLWSRLQESISKNSFDTPLYRFNIPNLRVGTLDSLLALSDDLLKANTFIEACSHKIRRQIEDLEKLSGILSSSLTVDGVPVDSYLTKFVWDEAKYPTMSPLKEIVDGIHVHVAKIDDDLKIRIAEYNNVRSQLNAINRKQTGSLAVRDLSNLVKPEDLVTSEHLITLIAVVPKYSQKDWLSSYETLTTYVVPRSSKNLHEDNEYAIYTVTLFIRDADNFRTKAREKGFQVRDFEYNSETQESR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G435200`
TK1151 ID	TkA07G435200
OH-1004 ID	LXL04_030835
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G435200

Location Chr07:110156575-110161154 (+)

Description Similar to VHA-C: V-type proton ATPase subunit C

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12840`	Subunit of the peripheral V1 complex of vacuolar ATPase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030835 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009826 unidimensional cell growth Biological Process

GO:0000221 vacuolar proton-transporting V-type ATPase, V1 domain Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005765 lysosomal membrane Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005774 vacuolar membrane Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0030665 clathrin-coated vesicle membrane Cellular Component

GO:0046961 proton-transporting ATPase activity, rotational mechanism Molecular Function

KEGG gene cross-reference

ath:AT1G12840

mcf:101866706

pon:100171885

xla:495092

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.586

Rank 1 · TkA07G435200 · TK1151

Nucleus0.251

Rank 2 · TkA07G435200 · TK1151

Golgi apparatus0.171

Rank 3 · TkA07G435200 · TK1151

Lysosome / Vacuole0.156

Rank 4 · TkA07G435200 · TK1151

Endoplasmic reticulum0.064

Rank 5 · TkA07G435200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03223V-ATPase_C5-367 aa

PF18548MetOD265-90 aa

PF07500TFIIS_M144-179 aa

PF07500TFIIS_M213-249 aa

PF18548MetOD2241-270 aa

PF07500TFIIS_M258-269 aa

PF18548MetOD2320-344 aa

PF07500TFIIS_M325-345 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G435200	`PF03223`	V-ATPase_C	5	367	2.6e-127	426.0
TkA07G435200	`PF18548`	MetOD2	65	90	0.32	11.7
TkA07G435200	`PF07500`	TFIIS_M	144	179	1.3	10.2
TkA07G435200	`PF07500`	TFIIS_M	213	249	1.3	10.2
TkA07G435200	`PF18548`	MetOD2	241	270	0.32	11.7
TkA07G435200	`PF07500`	TFIIS_M	258	269	1.3	10.2
TkA07G435200	`PF18548`	MetOD2	320	344	0.32	11.7
TkA07G435200	`PF07500`	TFIIS_M	325	345	1.3	10.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SDS7`	Arabidopsis thaliana	sp\|Q9SDS7\|VATC_ARATH V-type proton ATPase subunit C	78.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card