TkA07G432950 | RubberDandelionOmics

Gene overview

TkA07G432950

Reference: TK1151 Chr: Chr07 Coordinates: 109552762-109556031 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2463 bp · TkA07G432950|TK1151|cDNA

CCCACCATTTTTCCAATTCGGAGAAACCATCTTTCTCCTCCGGTCACCGGTCTGTTTCTTCACGGAGGTTCCTTCCGGCGCAAGCAAACATGTCGGTTGTTTGCCGCCGCCGCCTCCTCTTCCTTTCCCTTTTCCTTTTTTTCCGACCAATTCTCTCCCAACAGTCCCCCGCCGACGCCGCCGCCCTCCTCCAATTCAAAAAATCGTTTTCAAAATCCGATACTTTATCGAACTGGAAAGACGACGGGTCCCACCCCTGC...

CDS

Download CDS FASTA

1986 bp · TkA07G432950|TK1151|CDS

ATGTCGGTTGTTTGCCGCCGCCGCCTCCTCTTCCTTTCCCTTTTCCTTTTTTTCCGACCAATTCTCTCCCAACAGTCCCCCGCCGACGCCGCCGCCCTCCTCCAATTCAAAAAATCGTTTTCAAAATCCGATACTTTATCGAACTGGAAAGACGACGGGTCCCACCCCTGCGACCCGAACAATGTCTGGATCGGAATTATCTGTTCGAATGGTCAAATTAACAGCATCAATGTCGCCGAGATGGATCTTCAAGGACAACC...

Protein

Download Protein FASTA

661 aa · TkA07G432950|TK1151|PROTEIN

MSVVCRRRLLFLSLFLFFRPILSQQSPADAAALLQFKKSFSKSDTLSNWKDDGSHPCDPNNVWIGIICSNGQINSINVAEMDLQGQPDFRTLESIEGLKAISLENNSLVGPMPEINHLEYLKAFYAGSNWFSGVIPSDFFQTLGSLKKLWLQRNNFSGQIPESVGELPNLKELHLEYNDFTGPIPAFSDSDILIHLDLSNNRLQGEVPKCLKKFDAKSFDNNADLCGGPLSIKCKEAPSHPLEESTDTKSSTPWIIMIVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G432950`
TK1151 ID	TkA07G432950
OH-1004 ID	LXL04_030811
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.800
Protein coverage (%)	TK1151 100.000 / OH-1004 33.233 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G432950

Location Chr07:109552762-109556031 (+)

Description Similar to PRK3: Pollen receptor-like kinase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g42880`	Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.	No verified direct reference in this release
`At5g20690`	Key receptor for sensing species-specific attractants in cooperation with other pollen receptor-like kinases.	Tip-localized receptors control pollen tube growth and LURE sensing in Arabidopsis.2016 · DOI: 10.1038/nature17413 Structural basis for receptor recognition of pollen tube attraction peptides.2017 · DOI: 10.1038/s41467-017-01323-8
`At2g07040`	Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.	A distinct mechanism regulating a pollen-specific guanine nucleotide exchange factor for the small GTPase Rop in Arabidopsis thaliana.2007 · DOI: 10.1073/pnas.0705874104 AtPRK2 promotes ROP1 activation via RopGEFs in the control of polarized pollen tube growth.2013 · DOI: 10.1093/mp/sss103 The juxtamembrane and carboxy-terminal domains of Arabidopsis PRK2 are critical for ROP-induced growth in pollen tubes.2013 · DOI: 10.1093/jxb/ert323
`At5g35390`	Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.	AtPRK2 promotes ROP1 activation via RopGEFs in the control of polarized pollen tube growth.2013 · DOI: 10.1093/mp/sss103
`At3g20190`	Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030811 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016324 apical plasma membrane Cellular Component

GO:0045177 apical part of cell Cellular Component

GO:0090404 pollen tube tip Cellular Component

GO:0090406 pollen tube Cellular Component

KEGG gene cross-reference

ath:AT2G07040

ath:AT3G42880

ath:AT4G31250

ath:AT5G20690

ath:AT5G35390

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.883

Rank 1 · TkA07G432950 · TK1151

Cytoplasm0.078

Rank 2 · TkA07G432950 · TK1151

Endoplasmic reticulum0.073

Rank 3 · TkA07G432950 · TK1151

Nucleus0.055

Rank 4 · TkA07G432950 · TK1151

Golgi apparatus0.019

Rank 5 · TkA07G432950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_227-69 aa

PF25019LRR_R13L1-DRL2166-123 aa

PF23598LRR_1492-176 aa

PF13855LRR_894-108 aa

PF12799LRR_496-108 aa

PF00560LRR_198-114 aa

PF00560LRR_1121-140 aa

PF25019LRR_R13L1-DRL21131-176 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G432950	`PF08263`	LRRNT_2	27	69	6.9e-09	36.5
TkA07G432950	`PF25019`	LRR_R13L1-DRL21	66	123	0.055	14.1
TkA07G432950	`PF23598`	LRR_14	92	176	0.2	11.1
TkA07G432950	`PF13855`	LRR_8	94	108	8.6e-10	39.0
TkA07G432950	`PF12799`	LRR_4	96	108	5.6e-08	33.5
TkA07G432950	`PF00560`	LRR_1	98	114	2.2e-13	48.2
TkA07G432950	`PF00560`	LRR_1	121	140	2.2e-13	48.2
TkA07G432950	`PF25019`	LRR_R13L1-DRL21	131	176	0.055	14.1
TkA07G432950	`PF13855`	LRR_8	134	180	8.6e-10	39.0
TkA07G432950	`PF00560`	LRR_1	145	167	2.2e-13	48.2
TkA07G432950	`PF12799`	LRR_4	145	181	5.6e-08	33.5
TkA07G432950	`PF13516`	LRR_6	145	157	0.039	14.7
TkA07G432950	`PF07723`	LRR_2	145	158	0.066	14.6
TkA07G432950	`PF26019`	HTH_TIMELESS	166	193	0.1	13.6
TkA07G432950	`PF13516`	LRR_6	168	182	0.039	14.7
TkA07G432950	`PF00560`	LRR_1	169	186	2.2e-13	48.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1L7`	Arabidopsis thaliana	sp\|Q9M1L7\|PRK3_ARATH Pollen receptor-like kinase 3	42.200%	Swiss-Prot	Medium
`Q3E991`	Arabidopsis thaliana	sp\|Q3E991\|PRK6_ARATH Pollen receptor-like kinase 6	43.300%	Swiss-Prot	Medium
`Q84JQ4`	Arabidopsis thaliana	sp\|Q84JQ4\|PRK2_ARATH Pollen receptor-like kinase 2	34.100%	Swiss-Prot	Medium
`C0LGU0`	Arabidopsis thaliana	sp\|C0LGU0\|PRK1_ARATH Pollen receptor-like kinase 1	32.400%	Swiss-Prot	Medium
`Q9LJY0`	Arabidopsis thaliana	sp\|Q9LJY0\|PRK4_ARATH Pollen receptor-like kinase 4	29.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card