LXL04_030811 | RubberDandelionOmics

Gene overview

LXL04_030811

Reference: OH-1004 Chr: Chr06 Coordinates: 123116136-123126510 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5970 bp · LXL04_030811|LXL04_030811|OH1004|cDNA

ATGTCGGTTGTTTGCCGCCGCCGCCTCCTCTTCCTTTCCATTTTCCTTTTTTTCCGTCCATTTCTCTCCCAACAGTCCCCCGCCGACGCCGCCGCCCTCCTCCGATTCAAAAAATCGTTTTCAAAATCCGATACTTTATCGAACTGGAAAGACGACGGGTCCCACCCCTGCGACCCGAACAATGTCTGGATCGGAATTATCTGTTCGAATGGTCAAATTAACAGCATCAATGTCGCCGACATGGATCTTCAAGGACAACC...

CDS

Download CDS FASTA

5970 bp · LXL04_030811|LXL04_030811|OH1004|CDS

ATGTCGGTTGTTTGCCGCCGCCGCCTCCTCTTCCTTTCCATTTTCCTTTTTTTCCGTCCATTTCTCTCCCAACAGTCCCCCGCCGACGCCGCCGCCCTCCTCCGATTCAAAAAATCGTTTTCAAAATCCGATACTTTATCGAACTGGAAAGACGACGGGTCCCACCCCTGCGACCCGAACAATGTCTGGATCGGAATTATCTGTTCGAATGGTCAAATTAACAGCATCAATGTCGCCGACATGGATCTTCAAGGACAACC...

Protein

Download Protein FASTA

1989 aa · LXL04_030811|LXL04_030811|OH1004|PROTEIN

MSVVCRRRLLFLSIFLFFRPFLSQQSPADAAALLRFKKSFSKSDTLSNWKDDGSHPCDPNNVWIGIICSNGQINSINVADMDLQGQPDFRTLESIEGLKAISLENNSLVGPMPEINHLEYLKAFYAGSNWFSGVIPSDFFQTLGSLKKLWLQRNNFSGQIPESVGELPNLKELHLEYNDFTGPIPAFSDSDILIHLDLSNNRLQGEVPKSLKKFDAKSFDNNADLCGGPLSIKCKEAPSHPLEESTDTKSSTPWIIMIVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030811`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030811

Location Chr06:123116136-123126510 (+)

Description Similar to PRK3: Pollen receptor-like kinase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g42880`	Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.	No verified direct reference in this release
`At5g20690`	Key receptor for sensing species-specific attractants in cooperation with other pollen receptor-like kinases.	Tip-localized receptors control pollen tube growth and LURE sensing in Arabidopsis.2016 · DOI: 10.1038/nature17413 Structural basis for receptor recognition of pollen tube attraction peptides.2017 · DOI: 10.1038/s41467-017-01323-8
`At4g31250`	Probable LRR receptor-like serine/threonine-protein kinase At4g31250.	No verified direct reference in this release
`At5g35390`	Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.	AtPRK2 promotes ROP1 activation via RopGEFs in the control of polarized pollen tube growth.2013 · DOI: 10.1093/mp/sss103
`At2g07040`	Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.	A distinct mechanism regulating a pollen-specific guanine nucleotide exchange factor for the small GTPase Rop in Arabidopsis thaliana.2007 · DOI: 10.1073/pnas.0705874104 AtPRK2 promotes ROP1 activation via RopGEFs in the control of polarized pollen tube growth.2013 · DOI: 10.1093/mp/sss103 The juxtamembrane and carboxy-terminal domains of Arabidopsis PRK2 are critical for ROP-induced growth in pollen tubes.2013 · DOI: 10.1093/jxb/ert323

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030811 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009846 pollen germination Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0080092 regulation of pollen tube growth Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016324 apical plasma membrane Cellular Component

GO:0045177 apical part of cell Cellular Component

GO:0090404 pollen tube tip Cellular Component

GO:0090406 pollen tube Cellular Component

KEGG gene cross-reference

ath:AT2G07040

ath:AT3G42880

ath:AT4G31250

ath:AT5G20690

ath:AT5G35390

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.418

Rank 1 · LXL04_030811 · OH-1004

Cytoplasm0.241

Rank 2 · LXL04_030811 · OH-1004

Nucleus0.218

Rank 3 · LXL04_030811 · OH-1004

Endoplasmic reticulum0.146

Rank 4 · LXL04_030811 · OH-1004

Extracellular0.069

Rank 5 · LXL04_030811 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_227-69 aa

PF13855.13LRR_8134-180 aa

PF07714.24PK_Tyr_Ser-Thr389-591 aa

PF00069.32Pkinase389-600 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030811	`PF08263.18`	LRRNT_2	27	69	9e-08	33.0
LXL04_030811	`PF13855.13`	LRR_8	134	180	2.8e-08	34.1
LXL04_030811	`PF07714.24`	PK_Tyr_Ser-Thr	389	591	3.7e-25	89.4
LXL04_030811	`PF00069.32`	Pkinase	389	600	2.3e-24	86.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1L7`	Arabidopsis thaliana	Pollen receptor-like kinase 3	46.246%	Swiss-Prot	weak database homology
`Q3E991`	Arabidopsis thaliana	Pollen receptor-like kinase 6	45.191%	Swiss-Prot	weak database homology
`C0LGR9`	Arabidopsis thaliana	Probable LRR receptor-like serine/threonine-protein kinase At4g31250	37.009%	Swiss-Prot	weak database homology
`C0LGU0`	Arabidopsis thaliana	Pollen receptor-like kinase 1	35.266%	Swiss-Prot	weak database homology
`Q84JQ4`	Arabidopsis thaliana	Pollen receptor-like kinase 2	34.756%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card