TkA07G429630 | RubberDandelionOmics

Gene overview

TkA07G429630

Reference: TK1151 Chr: Chr07 Coordinates: 108749442-108754942 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3281 bp · TkA07G429630|TK1151|cDNA

ATTCCTTCCTCCATTACTGCATACCAAACACAGCCCTAGCGTTTGCAATGACATAACAAAGGTTCTCTTGAGAACGACTAAAAGTCGAGGGACTGGGCATGGGTATACATGAAAGTTAATTCCAAATCAAAATAGAAACACCGGGAAGCAAAAGAGCTGCCGAGCACGGAGCAGCGATGAACGGCGGCGAAAAAACAGAGAATGAGAACGGAAGTGAACAGAGCACTAATAACAAAGTACTCCAGAAGGTTGGAACAGTC...

CDS

Download CDS FASTA

2943 bp · TkA07G429630|TK1151|CDS

ATGAACGGCGGCGAAAAAACAGAGAATGAGAACGGAAGTGAACAGAGCACTAATAACAAAGTACTCCAGAAGGTTGGAACAGTCATCGCCACGATCAACGAAGCCAAAAACGTTGACCAAGTTATTTGCGCCCTCCACTCTTTTGCTGTTCGCCTTTTCTCTCTCGAGTCCCACGCATTCGCCGGTAGCATCGACAAAGAGTATAGAGATGAGGTTATTGGAACAGAACTTCCTTCAGTACACGAAAGAGATAGCTGGTG...

Protein

Download Protein FASTA

980 aa · TkA07G429630|TK1151|PROTEIN

MNGGEKTENENGSEQSTNNKVLQKVGTVIATINEAKNVDQVICALHSFAVRLFSLESHAFAGSIDKEYRDEVIGTELPSVHERDSWWQVFYQSTAFPTMARVLLLDVASNWLTCFPISAKKHLYDVFFLRGLVSEVIQTLVPYLQHHSNGRLETTVCSNTERLLALCLLENNGVLQLTREFSHQSKDRNLEQQKAAISRVSQLVTSVPDKARLGASTLLSSHLYIKRITIQLIQGAEEWNKKYHDELVNYNDTHFNGCML...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G429630`
TK1151 ID	TkA07G429630
OH-1004 ID	LXL04_030769
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G429630`
Location	Chr07:108749442-108754942 (+)
Description	Similar to telo2: Telomere length regulation protein TEL2 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030769` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0050821 protein stabilization Biological Process GO:0051083 'de novo' cotranslational protein folding Biological Process GO:2000003 positive regulation of DNA damage checkpoint Biological Process GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0016604 nuclear body Cellular Component GO:0110078 TTT Hsp90 cochaperone complex Cellular Component GO:0019900 kinase binding Molecular Function GO:0019901 protein kinase binding Molecular Function
KEGG gene cross-reference	dre:777634 hsa:9894 mmu:71718 xtr:780338 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.651

Rank 1 · TkA07G429630 · TK1151

Cytoplasm0.272

Rank 2 · TkA07G429630 · TK1151

Endoplasmic reticulum0.057

Rank 3 · TkA07G429630 · TK1151

Cell membrane0.054

Rank 4 · TkA07G429630 · TK1151

Golgi apparatus0.053

Rank 5 · TkA07G429630 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10193Telomere_reg-2177-216 aa

PF25320TELO2_ARM275-514 aa

PF10193Telomere_reg-2615-726 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G429630	`PF10193`	Telomere_reg-2	177	216	9.6e-23	81.4
TkA07G429630	`PF25320`	TELO2_ARM	275	514	2.3e-116	388.1
TkA07G429630	`PF10193`	Telomere_reg-2	615	726	9.6e-23	81.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card