LXL04_030769 | RubberDandelionOmics

Gene overview

LXL04_030769

Reference: OH-1004 Chr: Chr06 Coordinates: 122361337-122366355 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2967 bp · LXL04_030769|LXL04_030769|OH1004|cDNA

ATGAACGGCGGCGAAAAAACAGAGAATGAGAACGGAAGTGAACAGAGCACTAATAACAAAGTACTCCAGAAGGTTGAAACAGTCATCGCCACGATCAACGAAGCCAAAAACGTTGACCAAGTTATTTGCGCCCTCCACTCTTTTGCTGTTCGCCTTTTCTCTCTCGAGTCCCACGCATTCGCCGGTCGTTTATCTGTCTCCACTTTCAGTAGCATCGACAAAGAGTATAGAGATGAGGTTATTGGAACAGAACTTCCTTC...

CDS

Download CDS FASTA

2967 bp · LXL04_030769|LXL04_030769|OH1004|CDS

ATGAACGGCGGCGAAAAAACAGAGAATGAGAACGGAAGTGAACAGAGCACTAATAACAAAGTACTCCAGAAGGTTGAAACAGTCATCGCCACGATCAACGAAGCCAAAAACGTTGACCAAGTTATTTGCGCCCTCCACTCTTTTGCTGTTCGCCTTTTCTCTCTCGAGTCCCACGCATTCGCCGGTCGTTTATCTGTCTCCACTTTCAGTAGCATCGACAAAGAGTATAGAGATGAGGTTATTGGAACAGAACTTCCTTC...

Protein

Download Protein FASTA

988 aa · LXL04_030769|LXL04_030769|OH1004|PROTEIN

MNGGEKTENENGSEQSTNNKVLQKVETVIATINEAKNVDQVICALHSFAVRLFSLESHAFAGRLSVSTFSSIDKEYRDEVIGTELPSVHERDSWWQVFYQSTAFPTMARVLLLDVASNWLTCFPISAKKHLYDVFFLRGLVSEVIQTLVPYLQHHSNGRLETTVCSNTERLLALCLLENNGVLQLTREFSHQSKDRNLEQQKAAISRVSQLVTSVPDKARLGASTLLSSHLYIKRITIQLIQGAEEWNKKYHDELVNYND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030769`
TK1151 ID	TkA07G429630
OH-1004 ID	LXL04_030769
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_030769`
Location	Chr06:122361337-122366355 (+)
Description	Similar to telo2: Telomere length regulation protein TEL2 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030769` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0050821 protein stabilization Biological Process GO:0051083 'de novo' cotranslational protein folding Biological Process GO:2000003 positive regulation of DNA damage checkpoint Biological Process GO:0000781 chromosome, telomeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component GO:0016604 nuclear body Cellular Component GO:0110078 TTT Hsp90 cochaperone complex Cellular Component GO:0019900 kinase binding Molecular Function GO:0019901 protein kinase binding Molecular Function
KEGG gene cross-reference	dre:777634 hsa:9894 mmu:71718 xtr:780338 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.663

Rank 1 · LXL04_030769 · OH-1004

Cytoplasm0.265

Rank 2 · LXL04_030769 · OH-1004

Endoplasmic reticulum0.056

Rank 3 · LXL04_030769 · OH-1004

Cell membrane0.053

Rank 4 · LXL04_030769 · OH-1004

Golgi apparatus0.051

Rank 5 · LXL04_030769 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25320.2TELO2_ARM283-522 aa

PF10193.15Telomere_reg-2623-734 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030769	`PF25320.2`	TELO2_ARM	283	522	2.3e-116	388.1
LXL04_030769	`PF10193.15`	Telomere_reg-2	623	734	8.9e-23	81.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card