TkA07G426290 | RubberDandelionOmics

Gene overview

TkA07G426290

Reference: TK1151 Chr: Chr07 Coordinates: 107771623-107781045 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1510 bp · TkA07G426290|TK1151|cDNA

CAACAATGCATTTTCATTTTCCAGGTTCTTTTAACTTGGTGATAAAAAGGAATGCTAATTAAACACGATGTCGAAACCCTAAACCTCCATCGGTTACATAAAAACACATCCAACGGATGACAACTGAAATGGTCCCACTATTTCAATCACAGAAACCAACGCGCGTAAACGGAGCGTGGATTAAACCAAAAAAGGAAGGATAGAAGTGAAAGAAGGAGAGGATGGTGCATGATGATGATGATGGATGAGACCAGACATTC...

CDS

Download CDS FASTA

843 bp · TkA07G426290|TK1151|CDS

ATGGAGGAAATGTACGGTTTAATGAATTACCACGAGCAAGTTCCGCCGGCAGATGCGGCGGCGAGAGAGAATTACCATCACGATTTTCATGATCAACGCACAATTCCGGCGGTGTTTGGATCAGGATCCAATGTTAATCAAAGTAGTAGTAGCAATAAGAATAATAACAACGGATTAGCTGAAGAATTAGAAGAGGATTTGTCAAGTGCTAATCGAGCTAAGATTATGTCGCATCCGCTATATCCGAAGCTGCTCCAAGC...

Protein

Download Protein FASTA

280 aa · TkA07G426290|TK1151|PROTEIN

MEEMYGLMNYHEQVPPADAAARENYHHDFHDQRTIPAVFGSGSNVNQSSSSNKNNNNGLAEELEEDLSSANRAKIMSHPLYPKLLQAYIACQKVGAPADISNLFDEIFSDNDFCRRSSASSCLGDDPELDEFMETYCEMLDKYRSDLARPFDEATTFLNNMQTQLTNLCKGTSITYHTDESVERSEEDVSRGELEMHKSNWTNEDRALKEKLLRKYSKYISSLKHEFSNKKKKGKLPKEARQVLLDWWNVHYRWPYPTEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G426290`
TK1151 ID	TkA07G426290
OH-1004 ID	LXL04_030727
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 98.929 / OH-1004 89.355 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G426290

Location Chr07:107771623-107781045 (+)

Description Similar to KNAT6: Homeobox protein knotted-1-like 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g23380`	Plays a role in meristem function.	KNAT6: an Arabidopsis homeobox gene involved in meristem activity and organ separation.2006 · DOI: 10.1105/tpc.106.041988
`At1g70510`	May play a role in meristem function, and may be involved in maintaining cells in an undifferentiated, meristematic state.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0302500`	Probable transcription factor that may be involved in shoot formation during early embryogenesis.	No verified direct reference in this release
`UniProt: A2Y007`	Probable transcription factor that may be involved in shoot formation during embryogenesis.	No verified direct reference in this release
`Os05g0129700`	Probable transcription factor that may be involved in shoot formation during embryogenesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030727 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001708 cell fate specification Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009888 tissue development Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0010089 xylem development Biological Process

GO:0010094 specification of carpel identity Biological Process

GO:0045165 cell fate commitment Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT1G23380

ath:AT1G70510

ath:AT4G08150

dosa:Os01g0302500

gmx:547796

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.961

Rank 1 · TkA07G426290 · TK1151

Cytoplasm0.098

Rank 2 · TkA07G426290 · TK1151

Cell membrane0.035

Rank 3 · TkA07G426290 · TK1151

Endoplasmic reticulum0.022

Rank 4 · TkA07G426290 · TK1151

Plastid0.014

Rank 5 · TkA07G426290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16493Meis_PKNOX_N69-143 aa

PF03790KNOX172-111 aa

PF03791KNOX2122-169 aa

PF03789ELK208-228 aa

PF16493Meis_PKNOX_N217-227 aa

PF05920Homeobox_KN247-277 aa

PF00046Homeodomain255-278 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G426290	`PF16493`	Meis_PKNOX_N	69	143	0.096	13.9
TkA07G426290	`PF03790`	KNOX1	72	111	4.7e-19	68.6
TkA07G426290	`PF03791`	KNOX2	122	169	3.6e-24	84.7
TkA07G426290	`PF03789`	ELK	208	228	1.3e-07	32.0
TkA07G426290	`PF16493`	Meis_PKNOX_N	217	227	0.096	13.9
TkA07G426290	`PF05920`	Homeobox_KN	247	277	5.3e-11	42.9
TkA07G426290	`PF00046`	Homeodomain	255	278	0.16	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JS6`	Arabidopsis thaliana	sp\|Q84JS6\|KNAT6_ARATH Homeobox protein knotted-1-like 6	53.000%	Swiss-Prot	High
`P46640`	Arabidopsis thaliana	sp\|P46640\|KNAT2_ARATH Homeobox protein knotted-1-like 2	59.900%	Swiss-Prot	High
`Q9FP29`	Oryza sativa subsp. japonica	sp\|Q9FP29\|KNOS1_ORYSJ Homeobox protein knotted-1-like 1	50.700%	Swiss-Prot	High
`A2Y007`	Oryza sativa subsp. indica	sp\|A2Y007\|KNOSA_ORYSI Homeobox protein knotted-1-like 10	50.500%	Swiss-Prot	High
`Q7GDL5`	Oryza sativa subsp. japonica	sp\|Q7GDL5\|KNOSA_ORYSJ Homeobox protein knotted-1-like 10	50.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card