LXL04_030727 | RubberDandelionOmics

Gene overview

LXL04_030727

Reference: OH-1004 Chr: Chr06 Coordinates: 121498536-121507634 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

933 bp · LXL04_030727|LXL04_030727|OH1004|cDNA

ATGGAGGAAATGTATGGTTTAATGAATTACCACGAGCAAGTTCCGCCGGCAGATGCGGCGGCGAGAGAGAATTACCATCACGATTTTCATGATCAACGCACAATTCCGGCGGTGTTTGGATCAGGATCCAATGTTAATCAAAGTAGTAGTAGCAATAAGAATAATAACAACGGATTAGCTGAAGAATTAGAAGATGATTTGTCAAGTGCTAATCGAGCTAAGATTATGTCGCATCCGCTATATCCGAAGCTGCTCCAAGC...

CDS

Download CDS FASTA

933 bp · LXL04_030727|LXL04_030727|OH1004|CDS

ATGGAGGAAATGTATGGTTTAATGAATTACCACGAGCAAGTTCCGCCGGCAGATGCGGCGGCGAGAGAGAATTACCATCACGATTTTCATGATCAACGCACAATTCCGGCGGTGTTTGGATCAGGATCCAATGTTAATCAAAGTAGTAGTAGCAATAAGAATAATAACAACGGATTAGCTGAAGAATTAGAAGATGATTTGTCAAGTGCTAATCGAGCTAAGATTATGTCGCATCCGCTATATCCGAAGCTGCTCCAAGC...

Protein

Download Protein FASTA

310 aa · LXL04_030727|LXL04_030727|OH1004|PROTEIN

MEEMYGLMNYHEQVPPADAAARENYHHDFHDQRTIPAVFGSGSNVNQSSSSNKNNNNGLAEELEDDLSSANRAKIMSHPLYPKLLQAYIACQKVGAPADISNLFDEIFSDNDFCRRSSASSCLGDDPELDEFMETYCEMLDKYRSDLARPFDEATTFLNNMQTQLTNLCKGTSITYHTDESVERSEEDVSRGELEVHKSNWTNEDRALKEKLLRKYSKYISSLKHEFSNKKKKGKLPKEARQVLLDWWNVHYRWPYPTEA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030727`
TK1151 ID	TkA07G426290
OH-1004 ID	LXL04_030727
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 98.929 / OH-1004 89.355 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030727

Location Chr06:121498536-121507634 (+)

Description Similar to KNAT6: Homeobox protein knotted-1-like 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g23380`	Plays a role in meristem function.	KNAT6: an Arabidopsis homeobox gene involved in meristem activity and organ separation.2006 · DOI: 10.1105/tpc.106.041988
`At1g70510`	May play a role in meristem function, and may be involved in maintaining cells in an undifferentiated, meristematic state.	No verified direct reference in this release
`At4g08150`	May play a role in meristem function, and may be involved in maintaining cells in an undifferentiated, meristematic state, and its expression disappears at the same time the shoot apex undergoes the transition from vegetative to reproductive development.	ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis.2002 · DOI: 10.1242/dev.129.8.1957 Developmental regulation and significance of KNOX protein trafficking in Arabidopsis.2003 · DOI: 10.1242/dev.00618 A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants.1994 · DOI: 10.1105/tpc.6.12.1859

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0302500`	Probable transcription factor that may be involved in shoot formation during early embryogenesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030727 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001708 cell fate specification Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009736 cytokinin-activated signaling pathway Biological Process

GO:0009888 tissue development Biological Process

GO:0010051 xylem and phloem pattern formation Biological Process

GO:0010073 meristem maintenance Biological Process

GO:0010089 xylem development Biological Process

GO:0010094 specification of carpel identity Biological Process

GO:0045165 cell fate commitment Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT1G23380

ath:AT1G70510

ath:AT4G08150

dosa:Os01g0302500

gmx:547796

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.967

Rank 1 · LXL04_030727 · OH-1004

Cytoplasm0.091

Rank 2 · LXL04_030727 · OH-1004

Cell membrane0.029

Rank 3 · LXL04_030727 · OH-1004

Endoplasmic reticulum0.018

Rank 4 · LXL04_030727 · OH-1004

Plastid0.013

Rank 5 · LXL04_030727 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03790.19KNOX172-111 aa

PF03791.19KNOX2122-169 aa

PF03789.19ELK208-228 aa

PF05920.18Homeobox_KN247-286 aa

PF00046.36Homeodomain255-287 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030727	`PF03790.19`	KNOX1	72	111	5.6e-19	68.3
LXL04_030727	`PF03791.19`	KNOX2	122	169	4.4e-24	84.5
LXL04_030727	`PF03789.19`	ELK	208	228	1.6e-07	31.8
LXL04_030727	`PF05920.18`	Homeobox_KN	247	286	6.7e-19	68.2
LXL04_030727	`PF00046.36`	Homeodomain	255	287	5.2e-07	30.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84JS6`	Arabidopsis thaliana	Homeobox protein knotted-1-like 6	58.273%	Swiss-Prot	strong database homology
`P46640`	Arabidopsis thaliana	Homeobox protein knotted-1-like 2	60.643%	Swiss-Prot	strong database homology
`P46639`	Arabidopsis thaliana	Homeobox protein knotted-1-like 1	54.959%	Swiss-Prot	strong database homology
`Q9FP29`	Oryza sativa subsp. japonica	Homeobox protein knotted-1-like 1	52.610%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card