TkA07G422600 | RubberDandelionOmics

Gene overview

TkA07G422600

Reference: TK1151 Chr: Chr07 Coordinates: 106821116-106825256 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2153 bp · TkA07G422600|TK1151|cDNA

GTTTTTTTCCGACTTCTGAATCCGTTCGTGTTCTTGTTTAGTTGGATAGTTCATAGTTAAAGAGGTTAACCATGAAACGAAGTAAATTAGACTGGTTCATGTCTTTAAGACAGAAACGATCGATTCAAGTTCTGATCGGGTTGGGGTTATTGTATCAGCTACTCATGGTCGGTTTCGAGGTGCCATTCGTGTTCAAATCAGTTACGCGAGAAAAAAATGAAGAACAACGCTCTAGAAATACCTTGTTCTACACCGACGGA...

CDS

Download CDS FASTA

1971 bp · TkA07G422600|TK1151|CDS

ATGAAACGAAGTAAATTAGACTGGTTCATGTCTTTAAGACAGAAACGATCGATTCAAGTTCTGATCGGGTTGGGGTTATTGTATCAGCTACTCATGGTCGGTTTCGAGGTGCCATTCGTGTTCAAATCAGTTACGCGAGAAAAAAATGAAGAACAACGCTCTAGAAATACCTTGTTCTACACCGACGGATTGCCCAAGGAATCGTTAGCTTTAGATAGTGAAGAAGAGTTACAGGAAAAGGAATCCCCAATTCGACCTCT...

Protein

Download Protein FASTA

656 aa · TkA07G422600|TK1151|PROTEIN

MKRSKLDWFMSLRQKRSIQVLIGLGLLYQLLMVGFEVPFVFKSVTREKNEEQRSRNTLFYTDGLPKESLALDSEEELQEKESPIRPLQKIREFKALSSLNFTIEFVNTTLGFGGIQTSAKEAFLVGKRFWEELQSPSMYNNINNMTERIKNQTIETCPGSITLPGSVFHEKGNIIVLPCGMTLGSHVTLVGKPREAHFEKEPKISLMKQGEVSQFMMELQGLKTVDGEDPPRILHLNPRLKGDWSGKPVIEQNTCYRMQW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G422600`
TK1151 ID	TkA07G422600
OH-1004 ID	LXL04_008582
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	77.100
Protein coverage (%)	TK1151 100.000 / OH-1004 79.015 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G422600

Location Chr07:106821116-106825256 (-)

Description Similar to GALT6: Hydroxyproline O-galactosyltransferase GALT6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g62620`	Possesses hydroxyproline O-galactosyltransferase activity.	A small multigene hydroxyproline-O-galactosyltransferase family functions in arabinogalactan-protein glycosylation, growth and development in Arabidopsis.2015 · DOI: 10.1186/s12870-015-0670-7
`At1g74800`	Possesses hydroxyproline O-galactosyltransferase activity.	Two Hydroxyproline Galactosyltransferases, GALT5 and GALT2, Function in Arabinogalactan-Protein Glycosylation, Growth and Development in Arabidopsis.2015 · DOI: 10.1371/journal.pone.0125624 A small multigene hydroxyproline-O-galactosyltransferase family functions in arabinogalactan-protein glycosylation, growth and development in Arabidopsis.2015 · DOI: 10.1186/s12870-015-0670-7
`At1g27120`	Possesses hydroxyproline O-galactosyltransferase activity.	A small multigene hydroxyproline-O-galactosyltransferase family functions in arabinogalactan-protein glycosylation, growth and development in Arabidopsis.2015 · DOI: 10.1186/s12870-015-0670-7
`At4g21060`	Possesses hydroxyproline O-galactosyltransferase activity.	Functional identification of a hydroxyproline-o-galactosyltransferase specific for arabinogalactan protein biosynthesis in Arabidopsis.2013 · DOI: 10.1074/jbc.m112.432609 Two Hydroxyproline Galactosyltransferases, GALT5 and GALT2, Function in Arabinogalactan-Protein Glycosylation, Growth and Development in Arabidopsis.2015 · DOI: 10.1371/journal.pone.0125624 A small multigene hydroxyproline-O-galactosyltransferase family functions in arabinogalactan-protein glycosylation, growth and development in Arabidopsis.2015 · DOI: 10.1186/s12870-015-0670-7
`At1g26810`	Beta-1,3-galactosyltransferase that transfers galactose from UDP-galactose to substrates with a terminal beta-N-acetylglucosamine (beta-GlcNAc) residue.	A unique beta1,3-galactosyltransferase is indispensable for the biosynthesis of N-glycans containing Lewis a structures in Arabidopsis thaliana.2007 · DOI: 10.1105/tpc.107.052985

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008582 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006493 protein O-linked glycosylation Biological Process

GO:0009101 glycoprotein biosynthetic process Biological Process

GO:0010208 pollen wall assembly Biological Process

GO:0010405 arabinogalactan protein metabolic process Biological Process

GO:0010493 Lewis a epitope biosynthetic process Biological Process

GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process

GO:0080147 root hair cell development Biological Process

GO:0180062 protein O-linked glycosylation via galactose Biological Process

GO:1900056 negative regulation of leaf senescence Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005768 endosome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

KEGG gene cross-reference

ath:AT1G26810

ath:AT1G27120

ath:AT1G74800

ath:AT4G21060

ath:AT5G62620

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.784

Rank 1 · TkA07G422600 · TK1151

Endoplasmic reticulum0.087

Rank 2 · TkA07G422600 · TK1151

Cytoplasm0.073

Rank 3 · TkA07G422600 · TK1151

Cell membrane0.071

Rank 4 · TkA07G422600 · TK1151

Extracellular0.059

Rank 5 · TkA07G422600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25474TPR_TmcB102-152 aa

PF00337Gal-bind_lectin176-375 aa

PF01762Galactosyl_T423-603 aa

PF02434Fringe491-603 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G422600	`PF25474`	TPR_TmcB	102	152	0.26	11.9
TkA07G422600	`PF00337`	Gal-bind_lectin	176	375	4.5e-28	98.1
TkA07G422600	`PF01762`	Galactosyl_T	423	603	1.5e-30	107.2
TkA07G422600	`PF02434`	Fringe	491	603	0.0081	16.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LV16`	Arabidopsis thaliana	sp\|Q9LV16\|B3GTJ_ARATH Hydroxyproline O-galactosyltransferase GALT6	61.800%	Swiss-Prot	High
`Q8RX55`	Arabidopsis thaliana	sp\|Q8RX55\|B3GTI_ARATH Hydroxyproline O-galactosyltransferase GALT5	59.900%	Swiss-Prot	High
`Q8GXG6`	Arabidopsis thaliana	sp\|Q8GXG6\|B3GTH_ARATH Hydroxyproline O-galactosyltransferase GALT4	56.100%	Swiss-Prot	High
`A7XDQ9`	Arabidopsis thaliana	sp\|A7XDQ9\|B3GTK_ARATH Hydroxyproline O-galactosyltransferase GALT2	55.100%	Swiss-Prot	High
`Q8L7F9`	Arabidopsis thaliana	sp\|Q8L7F9\|B3GTF_ARATH Beta-1,3-galactosyltransferase GALT1	36.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card