RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G421320
Reference: TK1151 Chr: Chr07 Coordinates: 106479160-106480507 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

732 bp · TkA07G421320|TK1151|cDNA

CCCTCAACTTTAAATTCTTCCGATTTTGGTTGAAAAAAAGTTAAGCAAAGCCCGGTCACAAGAACACAGACGCCGATCGAAGAAGCTCCGATCTCCTCCTCTATCGCTGCCAGACGCCGATCCCACCTCCGGCCTCTGATTCCACCTCCGGCACACAAAGGTACCTTTTGATCTCCGATAATCATCAACCCTAACAGATTCACCATGATCGAACCTCTCCCTTCAGTCTCCTCGCTCTCCCCTTCTGTTCTCTCTTTCCT...

CDS

Download CDS FASTA

528 bp · TkA07G421320|TK1151|CDS

ATGATCGAACCTCTCCCTTCAGTCTCCTCGCTCTCCCCTTCTGTTCTCTCTTTCCTTGACACCGAACTACACACTCCAGACGACCTTCTACAAGCTTCTAAACTCGTTTCCAACTTACAGAACGATTGCCATCTCCTAGACCAAAACCTCACAGACTTGCACCAAAACCTCGGATCATTTCTGTTTGCTTACTCTACACACTCAGATCAAGTGAGCCACCTCTTCAACAACATAAACACCAAATTAACCAGTTTCCAATC...

Protein

Download Protein FASTA

176 aa · TkA07G421320|TK1151|PROTEIN

MIEPLPSVSSLSPSVLSFLDTELHTPDDLLQASKLVSNLQNDCHLLDQNLTDLHQNLGSFLFAYSTHSDQVSHLFNNINTKLTSFQSSTSEKKEKSETFLGKELPALAREVARVEAVRVYAETALKLDTIVGDIEDAVSSSVNKTFRKQTSDHNSEVTKRKFETFKSKLHIWTLGM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G421320
TK1151 IDTkA07G421320
OH-1004 IDLXL04_030650
Relationship / confidenceSequence Supported Annotation Or Model Conflict / Review
Protein identity (%)100.000
Protein coverage (%)TK1151 88.636 / OH-1004 20.472
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G421320
LocationChr07:106479160-106480507 (-)
DescriptionSimilar to MAG2: RINT1-like protein MAG2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g47700 Functions in the anterograde transport of storage protein precursors from the endoplasmic reticulum (ER) to the Golgi complex and in the retrograde transport from the Golgi complex to the ER.
MAIGO2 is involved in exit of seed storage proteins from the endoplasmic reticulum in Arabidopsis thaliana.2006 · DOI: 10.1105/tpc.106.046151
MAIGO2 is involved in abscisic acid-mediated response to abiotic stresses and Golgi-to-ER retrograde transport.2013 · DOI: 10.1111/j.1399-3054.2012.01704.x
MAG2 and three MAG2-INTERACTING PROTEINs form an ER-localized complex to facilitate storage protein transport in Arabidopsis thaliana.2013 · DOI: 10.1111/tpj.12347
At1g08400 May function in the anterograde transport of protein from the endoplasmic reticulum (ER) to the Golgi complex and in the retrograde transport from the Golgi complex to the ER.
MAIGO2 is involved in abscisic acid-mediated response to abiotic stresses and Golgi-to-ER retrograde transport.2013 · DOI: 10.1111/j.1399-3054.2012.01704.x

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_030650 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006623 protein targeting to vacuole Biological Process
GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process
GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process
GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process
GO:0015031 protein transport Biological Process
GO:0060628 regulation of ER to Golgi vesicle-mediated transport Biological Process
GO:0005783 endoplasmic reticulum Cellular Component
GO:0005789 endoplasmic reticulum membrane Cellular Component
GO:0005829 cytosol Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0030134 COPII-coated ER to Golgi transport vesicle Cellular Component
GO:0030142 COPI-coated Golgi to ER transport vesicle Cellular Component
KEGG gene cross-reference
ath:AT1G08400
ath:AT3G47700
hsa:60561
mmu:72772
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.564
Rank 1 · TkA07G421320 · TK1151
Nucleus0.497
Rank 2 · TkA07G421320 · TK1151
Golgi apparatus0.049
Rank 3 · TkA07G421320 · TK1151
Endoplasmic reticulum0.041
Rank 4 · TkA07G421320 · TK1151
Mitochondrion0.034
Rank 5 · TkA07G421320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23649FKBP1526-95 aa
PF08700VPS51_Exo84_N28-60 aa
PF04513Baculo_PEP_C30-88 aa
PF10157BORCS634-82 aa
PF01017STAT_alpha36-97 aa
PF14357DUF440446-93 aa
PF21109Stonustoxin_helical68-107 aa
PF08700VPS51_Exo84_N70-87 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G421320PF23649FKBP1526950.01615.5
TkA07G421320PF08700VPS51_Exo84_N28600.005617.5
TkA07G421320PF04513Baculo_PEP_C30880.04814.4
TkA07G421320PF10157BORCS634820.1912.6
TkA07G421320PF01017STAT_alpha36970.04114.6
TkA07G421320PF14357DUF440446930.09614.1
TkA07G421320PF21109Stonustoxin_helical681070.07813.8
TkA07G421320PF08700VPS51_Exo84_N70870.005617.5
TkA07G421320PF06133Com_YlbF751430.03515.2
TkA07G421320PF14357DUF44041031540.09614.1
TkA07G421320PF04513Baculo_PEP_C1211570.04814.4
TkA07G421320PF10157BORCS61381660.1912.6
TkA07G421320PF08700VPS51_Exo84_N1391580.005617.5
TkA07G421320PF21109Stonustoxin_helical1471690.07813.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9STU3Arabidopsis thalianasp|Q9STU3|MAG2_ARATH RINT1-like protein MAG248.600%Swiss-ProtMedium
Q8GXP1Arabidopsis thalianasp|Q8GXP1|MAG2L_ARATH RINT1-like protein MAG2L30.500%Swiss-ProtMedium

JBrowse

View in Genome Browser