LXL04_030650 | RubberDandelionOmics

Gene overview

LXL04_030650

Reference: OH-1004 Chr: Chr06 Coordinates: 120262870-120265965 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2289 bp · LXL04_030650|LXL04_030650|OH1004|cDNA

ATGATCGAACCTCTCCCTTCAGTCTCCTCGCTCTCCCCTTCTGTTCTCTCTTTCCTTGACACCGAACTACACACTCCAGACGACCTTCTACAAGCTTCTAAACTCGTTTCCAACTTACAGAACGATTGCCATCTCCTAGACCAAAACCTCACAGACTTGCACCAAAACCTCGGATCATTTCTGTTTGCTTACTCTACACACTCAGATCAAGTGAGCCACCTCTTCAACAACATAAACACCAAATTAACCAGTTTCCAATC...

CDS

Download CDS FASTA

2289 bp · LXL04_030650|LXL04_030650|OH1004|CDS

ATGATCGAACCTCTCCCTTCAGTCTCCTCGCTCTCCCCTTCTGTTCTCTCTTTCCTTGACACCGAACTACACACTCCAGACGACCTTCTACAAGCTTCTAAACTCGTTTCCAACTTACAGAACGATTGCCATCTCCTAGACCAAAACCTCACAGACTTGCACCAAAACCTCGGATCATTTCTGTTTGCTTACTCTACACACTCAGATCAAGTGAGCCACCTCTTCAACAACATAAACACCAAATTAACCAGTTTCCAATC...

Protein

Download Protein FASTA

762 aa · LXL04_030650|LXL04_030650|OH1004|PROTEIN

MIEPLPSVSSLSPSVLSFLDTELHTPDDLLQASKLVSNLQNDCHLLDQNLTDLHQNLGSFLFAYSTHSDQVSHLFNNINTKLTSFQSSTSEKKEKSETFLGKELPALAREVARVEAVRVYAETALKLDTIVGDIEDAVSSSVNKTFRKQTSDHNSEEARFIAIKSIKLAEEVLTKVTKTRPQWSRLISAVDHRVDRALAILRPQSIADYRSLLTSLNWPPPLSTSHPQKSHNSTNPLLTMKPDIKTQYFDSFLALCKLQQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030650`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030650

Location Chr06:120262870-120265965 (-)

Description Similar to MAG2: RINT1-like protein MAG2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g47700`	Functions in the anterograde transport of storage protein precursors from the endoplasmic reticulum (ER) to the Golgi complex and in the retrograde transport from the Golgi complex to the ER.	MAIGO2 is involved in exit of seed storage proteins from the endoplasmic reticulum in Arabidopsis thaliana.2006 · DOI: 10.1105/tpc.106.046151 MAIGO2 is involved in abscisic acid-mediated response to abiotic stresses and Golgi-to-ER retrograde transport.2013 · DOI: 10.1111/j.1399-3054.2012.01704.x MAG2 and three MAG2-INTERACTING PROTEINs form an ER-localized complex to facilitate storage protein transport in Arabidopsis thaliana.2013 · DOI: 10.1111/tpj.12347
`At1g08400`	May function in the anterograde transport of protein from the endoplasmic reticulum (ER) to the Golgi complex and in the retrograde transport from the Golgi complex to the ER.	MAIGO2 is involved in abscisic acid-mediated response to abiotic stresses and Golgi-to-ER retrograde transport.2013 · DOI: 10.1111/j.1399-3054.2012.01704.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030650 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006623 protein targeting to vacuole Biological Process

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process

GO:0007095 mitotic G2 DNA damage checkpoint signaling Biological Process

GO:0015031 protein transport Biological Process

GO:0060628 regulation of ER to Golgi vesicle-mediated transport Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0030134 COPII-coated ER to Golgi transport vesicle Cellular Component

GO:0030142 COPI-coated Golgi to ER transport vesicle Cellular Component

KEGG gene cross-reference

ath:AT1G08400

ath:AT3G47700

hsa:60561

mmu:72772

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.507

Rank 1 · LXL04_030650 · OH-1004

Nucleus0.270

Rank 2 · LXL04_030650 · OH-1004

Golgi apparatus0.222

Rank 3 · LXL04_030650 · OH-1004

Lysosome / Vacuole0.122

Rank 4 · LXL04_030650 · OH-1004

Cell membrane0.079

Rank 5 · LXL04_030650 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04437.20RINT1_TIP1290-755 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030650	`PF04437.20`	RINT1_TIP1	290	755	3.5e-35	122.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9STU3`	Arabidopsis thaliana	RINT1-like protein MAG2	53.125%	Swiss-Prot	strong database homology
`Q8GXP1`	Arabidopsis thaliana	RINT1-like protein MAG2L	31.592%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card