TkA07G410020 | RubberDandelionOmics

Gene overview

TkA07G410020

Reference: TK1151 Chr: Chr07 Coordinates: 103523814-103528005 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2276 bp · TkA07G410020|TK1151|cDNA

AAAAATCTCCCACCACTCTCCCCCTCCCTCCTCCCGGACGCCAATAATCGGCGGTGCATAAAACCTCCACAAATTGCATTTACCGTCCATACCTTTCTCCCTCTTTCTCTCTCTAGAATCAAATATTATCATATTTTTTCTGGTTTTTCATCTCAAATTGGATCTCGGTTTTGATTCTGCTTCGTTCCCCCAAAATCACCAAGTCAAACGATGCAGCGAATCGTTGACAACTTTCTCGCTGTCACAAAAGAATCTGTGAA...

CDS

Download CDS FASTA

2040 bp · TkA07G410020|TK1151|CDS

ATGCAGCGAATCGTTGACAACTTTCTCGCTGTCACAAAAGAATCTGTGAAGACCATTACTTATGAAATATTAAGTAACATAGTACGGCTTATCAATGGAATATCCGCACTATTGCTATCTATATTACCTGGCAAAGCCAGTATTCTTGAAGGAATGCAAGGTTGGGAGCTCAAACCAAAATTACGTGGCCCTCGATTGCCACGTTGGATGGAAGATGGGGTGTCATCATTTAATCACATGATTCACGAACTATCGGTGGA...

Protein

Download Protein FASTA

679 aa · TkA07G410020|TK1151|PROTEIN

MQRIVDNFLAVTKESVKTITYEILSNIVRLINGISALLLSILPGKASILEGMQGWELKPKLRGPRLPRWMEDGVSSFNHMIHELSVEYDSAPSVEYSSGEDLDDYDDAYVYPASPMTPYSKFSRQPSFTKRERSRAHWILSIIMFFLIPARLLFGIPFYVIRTIFRRGGRSTVSSPGRAKTSQAAKKGIDHVVQRATDKRRGIVEDLHMGIEICIETVFDGIHYATRFVLSPFESIRMLLRWFFSRSMGKPRPDEPGTSV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G410020`
TK1151 ID	TkA07G410020
OH-1004 ID	LXL04_030532
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.853 / OH-1004 76.437 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G410020`
Location	Chr07:103523814-103528005 (+)
Description	Similar to Lipn: Lipase member N
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030532` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006108 malate metabolic process Biological Process GO:0006629 lipid metabolic process Biological Process GO:0016042 lipid catabolic process Biological Process GO:0005576 extracellular region Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005764 lysosome Cellular Component GO:0043202 lysosomal lumen Cellular Component GO:0004771 sterol ester esterase activity Molecular Function GO:0004806 triacylglycerol lipase activity Molecular Function GO:0016298 lipase activity Molecular Function GO:0016615 malate dehydrogenase activity Molecular Function
KEGG gene cross-reference	bta:281283 cel:CELE_F54F3.3 cfa:403867 mmu:70166 rno:50682 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.303

Rank 1 · TkA07G410020 · TK1151

Mitochondrion0.226

Rank 2 · TkA07G410020 · TK1151

Cytoplasm0.181

Rank 3 · TkA07G410020 · TK1151

Golgi apparatus0.160

Rank 4 · TkA07G410020 · TK1151

Nucleus0.136

Rank 5 · TkA07G410020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22113Mtrc-MtrF_II-IV_dom75-87 aa

PF12697Abhydrolase_688-88 aa

PF09002Card1_endonuc197-216 aa

PF09002Card1_endonuc233-248 aa

PF04083Abhydro_lipase291-345 aa

PF00561Abhydrolase_1327-404 aa

PF12697Abhydrolase_6332-485 aa

PF22113Mtrc-MtrF_II-IV_dom394-439 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G410020	`PF22113`	Mtrc-MtrF_II-IV_dom	75	87	0.31	11.3
TkA07G410020	`PF12697`	Abhydrolase_6	88	88	0.03	15.7
TkA07G410020	`PF09002`	Card1_endonuc	197	216	0.35	11.3
TkA07G410020	`PF09002`	Card1_endonuc	233	248	0.35	11.3
TkA07G410020	`PF04083`	Abhydro_lipase	291	345	2e-15	56.8
TkA07G410020	`PF00561`	Abhydrolase_1	327	404	0.019	15.4
TkA07G410020	`PF12697`	Abhydrolase_6	332	485	0.03	15.7
TkA07G410020	`PF22113`	Mtrc-MtrF_II-IV_dom	394	439	0.31	11.3
TkA07G410020	`PF09002`	Card1_endonuc	409	450	0.35	11.3
TkA07G410020	`PF12146`	Hydrolase_4	423	500	8.7e-07	29.2
TkA07G410020	`PF06821`	Ser_hydrolase	423	468	0.17	12.5
TkA07G410020	`PF00561`	Abhydrolase_1	432	474	0.019	15.4
TkA07G410020	`PF12146`	Hydrolase_4	598	633	8.7e-07	29.2
TkA07G410020	`PF00561`	Abhydrolase_1	599	626	0.019	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card