TkA07G408480 | RubberDandelionOmics

Gene overview

TkA07G408480

Reference: TK1151 Chr: Chr07 Coordinates: 102754589-102759194 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2000 bp · TkA07G408480|TK1151|cDNA

AACCGGGGAAGCCATTAACGACGATAAAGCTAAAGCAAGCCTAGAAAAATCACTTCCATTTTATCCATTACTTACCTATAATGAGTGTATGCTTTCATTCAGTAGTGAAGCCTTTCGTTCCCTTTTCTCGATTCAACTCCAATCAGTGCACTTGGAACCCTAATTCTACAGCCCATTTTTCCATCCAGAATTACAGTAATAGTCTTACAAGGGTTAAGCCTCACCATCGTTTCCATCTGTCCATTAAAGTTCTAGAACAC...

CDS

Download CDS FASTA

597 bp · TkA07G408480|TK1151|CDS

ATGAAGAACGGAAAGGAGTTTCTTCTTACAGACACTGTTGGGTTTATTCAAAAACTACCAACAACTCTGGTTGCGGCTTTTAGGGCGACACTAGAGGAAATATCTGAGTCGTCGCTTTTAGTGCATGTGATAGATATAAGTCATCCACTTGTGGAACAACAAATTGATGCGGTGGAAAAAGTACTTTCGGAATTAGATGCTTCATCGATTCCTAAGTTAATGGTTTGGAACAAGGTGGATAAGGCTGATAATCCAGCAGA...

Protein

Download Protein FASTA

198 aa · TkA07G408480|TK1151|PROTEIN

MKNGKEFLLTDTVGFIQKLPTTLVAAFRATLEEISESSLLVHVIDISHPLVEQQIDAVEKVLSELDASSIPKLMVWNKVDKADNPAEIKLKAKNMEDTICISALNGSGLDEFCNAIQEKLKDSMVWVEALVPFDKGELLSTIHQVGMVEGTEYMENGTLVRGYVPLRYARLLTPMRQTCVSQSPSLEEEEEDDEEILL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G408480`
TK1151 ID	TkA07G408480
OH-1004 ID	LXL04_030502
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 94.949 / OH-1004 32.982 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G408480`
Location	Chr07:102754589-102759194 (-)
Description	Similar to hflX: GTPase HflX (Escherichia coli (strain K12)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030502` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009408 response to heat Biological Process GO:0032790 ribosome disassembly Biological Process GO:0036289 peptidyl-serine autophosphorylation Biological Process GO:0072344 rescue of stalled cytosolic ribosome Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0003924 GTPase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0005525 GTP binding Molecular Function GO:0016887 ATP hydrolysis activity Molecular Function GO:0019843 rRNA binding Molecular Function GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	bpf:BpOF4_19480 csh:Closa_2505 ecj:JW4131 eco:b4173 ecoc:C3026_22550 fps:FP2414 tte:TTE1127 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.611

Rank 1 · TkA07G408480 · TK1151

Nucleus0.382

Rank 2 · TkA07G408480 · TK1151

Mitochondrion0.135

Rank 3 · TkA07G408480 · TK1151

Cell membrane0.060

Rank 4 · TkA07G408480 · TK1151

Endoplasmic reticulum0.052

Rank 5 · TkA07G408480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01926MMR_HSR13-78 aa

PF00009GTP_EFTU40-120 aa

PF19275HflX_C48-63 aa

PF03193RsgA_GTPase53-119 aa

PF16897MMR_HSR1_Xtn54-121 aa

PF19275HflX_C88-159 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G408480	`PF01926`	MMR_HSR1	3	78	2.5e-05	25.1
TkA07G408480	`PF00009`	GTP_EFTU	40	120	0.028	14.7
TkA07G408480	`PF19275`	HflX_C	48	63	5.3e-10	40.0
TkA07G408480	`PF03193`	RsgA_GTPase	53	119	0.05	14.1
TkA07G408480	`PF16897`	MMR_HSR1_Xtn	54	121	9.4e-06	26.3
TkA07G408480	`PF19275`	HflX_C	88	159	5.3e-10	40.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card