LXL04_030502 | RubberDandelionOmics

Gene overview

LXL04_030502

Reference: OH-1004 Chr: Chr06 Coordinates: 117373582-117376438 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1713 bp · LXL04_030502|LXL04_030502|OH1004|cDNA

ATGAGTGTATGCTTTCATTCAGTAGTGAAGCCTTTCGTTCCCTTTTCTCGATTCAACTCCAATCAGTGCACTTGGAACCCTAATTCTACAGCCCATTTTTCCATCCAGAATTACAGTAATAGTCTTACAAGGGTTAAGCCTCACCATCGTTTCCATCTGTCCATTAAAGTTCTAGAACACGGGACCGGAGTTCTATCACCTTCCGATGATGACACAGACATCTCCGTTGAGAGCCAATTAAATACCGTCGACGGAGAGCT...

CDS

Download CDS FASTA

1713 bp · LXL04_030502|LXL04_030502|OH1004|CDS

ATGAGTGTATGCTTTCATTCAGTAGTGAAGCCTTTCGTTCCCTTTTCTCGATTCAACTCCAATCAGTGCACTTGGAACCCTAATTCTACAGCCCATTTTTCCATCCAGAATTACAGTAATAGTCTTACAAGGGTTAAGCCTCACCATCGTTTCCATCTGTCCATTAAAGTTCTAGAACACGGGACCGGAGTTCTATCACCTTCCGATGATGACACAGACATCTCCGTTGAGAGCCAATTAAATACCGTCGACGGAGAGCT...

Protein

Download Protein FASTA

570 aa · LXL04_030502|LXL04_030502|OH1004|PROTEIN

MSVCFHSVVKPFVPFSRFNSNQCTWNPNSTAHFSIQNYSNSLTRVKPHHRFHLSIKVLEHGTGVLSPSDDDTDISVESQLNTVDGELQQLVDVAADEIITAPKKLTPKRLARKKENDEDDDDARFKLRNGKEVFEEKAYLVGVARKDDSEELFSIEESLKELAQLADTAGLMVVDSTYQKLSTPNSRTYIGSGKVSEIKTAINAHGVETVIFDDELSPGQLRNLEKAFGGNVRVCDRTALILDIFDQRAATREAALQVTL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030502`
TK1151 ID	TkA07G408480
OH-1004 ID	LXL04_030502
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 94.949 / OH-1004 32.982 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_030502`
Location	Chr06:117373582-117376438 (-)
Description	Similar to hflX: GTPase HflX (Escherichia coli (strain K12)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030502` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0009408 response to heat Biological Process GO:0032790 ribosome disassembly Biological Process GO:0036289 peptidyl-serine autophosphorylation Biological Process GO:0072344 rescue of stalled cytosolic ribosome Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0003924 GTPase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0005525 GTP binding Molecular Function GO:0016887 ATP hydrolysis activity Molecular Function GO:0019843 rRNA binding Molecular Function GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	bpf:BpOF4_19480 csh:Closa_2505 ecj:JW4131 eco:b4173 ecoc:C3026_22550 fps:FP2414 tte:TTE1127 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.939

Rank 1 · LXL04_030502 · OH-1004

Mitochondrion0.071

Rank 2 · LXL04_030502 · OH-1004

Nucleus0.028

Rank 3 · LXL04_030502 · OH-1004

Cytoplasm0.019

Rank 4 · LXL04_030502 · OH-1004

Cell membrane0.011

Rank 5 · LXL04_030502 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13167.12GTP-bdg_N156-245 aa

PF16360.11GTP-bdg_M248-325 aa

PF01926.30MMR_HSR1333-451 aa

PF02421.25FeoB_N333-484 aa

PF00350.30Dynamin_N334-369 aa

PF19275.5HflX_C461-532 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030502	`PF13167.12`	GTP-bdg_N	156	245	2.2e-32	112.2
LXL04_030502	`PF16360.11`	GTP-bdg_M	248	325	9.7e-27	94.0
LXL04_030502	`PF01926.30`	MMR_HSR1	333	451	8e-23	81.4
LXL04_030502	`PF02421.25`	FeoB_N	333	484	1e-06	29.1
LXL04_030502	`PF00350.30`	Dynamin_N	334	369	7.1e-06	26.9
LXL04_030502	`PF19275.5`	HflX_C	461	532	2.3e-09	37.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card