TkA07G372150 | RubberDandelionOmics

Gene overview

TkA07G372150

Reference: TK1151 Chr: Chr07 Coordinates: 93327843-93331198 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1826 bp · TkA07G372150|TK1151|cDNA

CCACCAAGCATTTATGAAGGAAAAAATATCAAAATTAAAATCATCTTCTGAGAATCTTTCTTTCTCCTTCTCACAAAAATCTTTCAAAAATTAGAAGAAAATAAAGCAGATTCTTGGTCAATTGGGTCGCAATCATAAAAAAAAAATCAATAATCAAATTATTTTTCGCTGAAACCAAACACCGTGTGTAGAATCTATTAATTTTTTCTATATATACGACTTGCTCTACCCTATACTTGATCAAAAACTTGTTAAATCCG...

CDS

Download CDS FASTA

1083 bp · TkA07G372150|TK1151|CDS

ATGGCCGTGAAGGTGAAGATCAATGGATTCATCGAGGGCACACAATCAGAAGAACTGATGAAACTACTTCTAACACTCGCTTCCAATTGGGGAGATGTTTTCGACGCAAACAAAGTGAAAGTCACACATCTAAGTGGCGCCATGACTAATGTAGTTTATCGACTTACATGGCCACAAAACAACGCCGCAAATGATGATCGGACAGTCCTGGTTCGGATCTACGGCGAAGGATCCGACATTTTTTTTGATCGGGAAGAAGA...

Protein

Download Protein FASTA

360 aa · TkA07G372150|TK1151|PROTEIN

MAVKVKINGFIEGTQSEELMKLLLTLASNWGDVFDANKVKVTHLSGAMTNVVYRLTWPQNNAANDDRTVLVRIYGEGSDIFFDREEEIRTFESISTHGHGPRLLGQCPQGRVEEFIHAKTLSASDLRDPEISNLIAVKMKEFHQLDISGSKVPLLWPRMRKWLITAKSLCSEEEVKEFQLDILENEIDTLEKELSQSYQDVAFCHNDLQYGNIMINEDTKCVTLIDYEYASYNPIAYDLANHFCEWAANYHTDTPHVMDY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G372150`
TK1151 ID	TkA07G372150
OH-1004 ID	LXL04_030035
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G372150

Location Chr07:93327843-93331198 (-)

Description Similar to CK1: Probable choline kinase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71697`	Involved in phospholipid biosynthesis.	No verified direct reference in this release
`At1g74320`	Involved in phospholipid biosynthesis.	No verified direct reference in this release
`At4g09760`	Involved in phospholipid biosynthesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030035 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006646 phosphatidylethanolamine biosynthetic process Biological Process

GO:0006656 phosphatidylcholine biosynthetic process Biological Process

GO:0008654 phospholipid biosynthetic process Biological Process

GO:0009611 response to wounding Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0016310 phosphorylation Biological Process

GO:0035264 multicellular organism growth Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004103 choline kinase activity Molecular Function

GO:0004305 ethanolamine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G71697

ath:AT1G74320

ath:AT2G26830

ath:AT4G09760

mmu:214253

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.720

Rank 1 · TkA07G372150 · TK1151

Nucleus0.484

Rank 2 · TkA07G372150 · TK1151

Mitochondrion0.070

Rank 3 · TkA07G372150 · TK1151

Cell membrane0.054

Rank 4 · TkA07G372150 · TK1151

Endoplasmic reticulum0.040

Rank 5 · TkA07G372150 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01633Choline_kinase41-336 aa

PF01636APH68-246 aa

PF01163RIO1168-227 aa

PF02958EcKL182-242 aa

PF19974TCAD9183-240 aa

PF12330Haspin_kinase196-231 aa

PF07914DUF1679202-242 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G372150	`PF01633`	Choline_kinase	41	336	4.7e-97	325.6
TkA07G372150	`PF01636`	APH	68	246	5.1e-14	53.3
TkA07G372150	`PF01163`	RIO1	168	227	0.16	12.3
TkA07G372150	`PF02958`	EcKL	182	242	2.5e-05	24.5
TkA07G372150	`PF19974`	TCAD9	183	240	0.001	19.0
TkA07G372150	`PF12330`	Haspin_kinase	196	231	0.0017	18.2
TkA07G372150	`PF07914`	DUF1679	202	242	0.1	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M9H6`	Arabidopsis thaliana	sp\|Q9M9H6\|CK1_ARATH Probable choline kinase 1	58.400%	Swiss-Prot	High
`Q8L518`	Arabidopsis thaliana	sp\|Q8L518\|CK2_ARATH Probable choline kinase 2	59.000%	Swiss-Prot	High
`Q9SZ92`	Arabidopsis thaliana	sp\|Q9SZ92\|CK3_ARATH Probable choline kinase 3	56.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card