LXL04_030035 | RubberDandelionOmics

Gene overview

LXL04_030035

Reference: OH-1004 Chr: Chr06 Coordinates: 106144746-106147329 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1089 bp · LXL04_030035|LXL04_030035|OH1004|cDNA

ATGGCCGTGAAGGTGAAGATCAATGGATTCATCGAGGGCACACAATCAGAAGAACTGATGAAACTACTTCTAACACTCGCTTCCAATTGGGGAGATGTTTTCGACGCAAACAAAGTGAAAGTCACACATCTAAGTGGCGCCATGACTAATGTGGTTTATCGACTTACATGGCCACAAAACAACGCCGCAAATGATGATCGGACAGTCCTGGTTCGGATCTACGGCGAAGGATCCGACATTTTTTTTGATCGGGAAGAAGA...

CDS

Download CDS FASTA

1089 bp · LXL04_030035|LXL04_030035|OH1004|CDS

ATGGCCGTGAAGGTGAAGATCAATGGATTCATCGAGGGCACACAATCAGAAGAACTGATGAAACTACTTCTAACACTCGCTTCCAATTGGGGAGATGTTTTCGACGCAAACAAAGTGAAAGTCACACATCTAAGTGGCGCCATGACTAATGTGGTTTATCGACTTACATGGCCACAAAACAACGCCGCAAATGATGATCGGACAGTCCTGGTTCGGATCTACGGCGAAGGATCCGACATTTTTTTTGATCGGGAAGAAGA...

Protein

Download Protein FASTA

362 aa · LXL04_030035|LXL04_030035|OH1004|PROTEIN

MAVKVKINGFIEGTQSEELMKLLLTLASNWGDVFDANKVKVTHLSGAMTNVVYRLTWPQNNAANDDRTVLVRIYGEGSDIFFDREEEIRTFESISTHGHGPRLLGQCPQGRVEEFIHAKTLSASDLRDPEISNLIAVKMKEFHQLDISGSKVPLLWPRMRKWLITAKSLCSEEEVKEFQLDILENEIDTLEKELSQSYQDVAFCHNDLQYGNIMINEDTKCVTLIDYEYASYNPIAYDLANHFCEWAANYHTDTPHVMDY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030035`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030035

Location Chr06:106144746-106147329 (-)

Description Similar to CK1: Probable choline kinase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71697`	Involved in phospholipid biosynthesis.	No verified direct reference in this release
`At1g74320`	Involved in phospholipid biosynthesis.	No verified direct reference in this release
`At4g09760`	Involved in phospholipid biosynthesis.	No verified direct reference in this release
`At2g26830`	Involved in phospholipid biosynthesis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030035 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006646 phosphatidylethanolamine biosynthetic process Biological Process

GO:0006656 phosphatidylcholine biosynthetic process Biological Process

GO:0008654 phospholipid biosynthetic process Biological Process

GO:0009611 response to wounding Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0016310 phosphorylation Biological Process

GO:0035264 multicellular organism growth Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004103 choline kinase activity Molecular Function

GO:0004305 ethanolamine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G71697

ath:AT1G74320

ath:AT2G26830

ath:AT4G09760

mmu:214253

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.714

Rank 1 · LXL04_030035 · OH-1004

Nucleus0.489

Rank 2 · LXL04_030035 · OH-1004

Mitochondrion0.069

Rank 3 · LXL04_030035 · OH-1004

Cell membrane0.053

Rank 4 · LXL04_030035 · OH-1004

Endoplasmic reticulum0.040

Rank 5 · LXL04_030035 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01633.27Choline_kinase41-338 aa

PF01636.30APH68-246 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030035	`PF01633.27`	Choline_kinase	41	338	4.4e-97	325.7
LXL04_030035	`PF01636.30`	APH	68	246	4.3e-14	53.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M9H6`	Arabidopsis thaliana	Probable choline kinase 1	58.908%	Swiss-Prot	strong database homology
`Q8L518`	Arabidopsis thaliana	Probable choline kinase 2	59.639%	Swiss-Prot	strong database homology
`Q9SZ92`	Arabidopsis thaliana	Probable choline kinase 3	57.267%	Swiss-Prot	strong database homology
`O81024`	Arabidopsis thaliana	Probable ethanolamine kinase	33.739%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card