RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G362650
Reference: TK1151 Chr: Chr07 Coordinates: 90854830-90860413 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4123 bp · TkA07G362650|TK1151|cDNA

AGTGACAGAATAATTTAACAAGCAGTATAAAATGGCAAACTAAATTGGCGTTCTTACATTTACTCCGCCAAACAGGCAAGAAATTCTCTCTTCGACTCCGCTTACTCCGACGGGACCACATTCCGATTTCGTCGCCTTCCGTCGTCAATTTACCTGCTTGACGGCCGGAACCGCCACTAATCCGCTTCAGTGATATCCCTTCATTATACCTCTTTTCCACGGTTGAAAAGAGATAAGCGTCAAACATCTTACTTTCCTCA...

CDS

Download CDS FASTA

3360 bp · TkA07G362650|TK1151|CDS

ATGGCAGATCTTGTTAGTTACGGTAACGCAGACCGTGACACCGAGCAGACATTAATTGCTCTGAAGAAGGGCGCTCAGTTACTTAAATATGGTCGCAAAGGGAAGCCCAAATTTTGTCCATTTCGACTTTCTCACGATGAATCATCTTTAATTTGGATTTCCACCAGTGGTGAAAGGAGTCTTAAATTATCTTTAGTTTCAAGAATTGTCCCCGGACAAAGAACCGCTGTTTTCAGACGTTACATACGCCCCGAAAAAGA...

Protein

Download Protein FASTA

1119 aa · TkA07G362650|TK1151|PROTEIN

MADLVSYGNADRDTEQTLIALKKGAQLLKYGRKGKPKFCPFRLSHDESSLIWISTSGERSLKLSLVSRIVPGQRTAVFRRYIRPEKDYLSFSLIYNNGKRSLDLICKDKVEAEVWIAGLRALISGQGGRSKIDGWSEGGGLNIEENKDSTSNSASDNSVSAPPDLSSPETSYGSNSNTSPMNNYQTSGSYEKSNTTFDQTNIQVKGFGSDAFRVSVSSAPSTSSHGSAQDDYDALGDVYIWGEVICDNNNNNNINTIKLT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G362650
TK1151 IDTkA07G362650
OH-1004 IDLXL04_031244
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)69.700
Protein coverage (%)TK1151 99.643 / OH-1004 99.806
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G362650
LocationChr07:90854830-90860413 (-)
DescriptionSimilar to PRAF1: PH, RCC1 and FYVE domains-containing protein 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g76950 Binds to phosphatidic acid and to phosphoinositides such as PtdIns3P, PtdIns(3,4)P(2), PtdIns(3,4,5)P(3) and PtdIns(4,5)P(2). No verified direct reference in this release
At5g63860 UV-B specific signaling component that acts as a UV-B photoreceptor and plays a key role in establishing UV-protective responses in plants.
A UV-B-specific signaling component orchestrates plant UV protection.2005 · DOI: 10.1073/pnas.0507187102
UV-B promotes rapid nuclear translocation of the Arabidopsis UV-B specific signaling component UVR8 and activates its function in the nucleus.2007 · DOI: 10.1105/tpc.107.053330
UV-B signaling pathways with different fluence-rate response profiles are distinguished in mature Arabidopsis leaf tissue by requirement for UVR8, HY5, and HYH.2008 · DOI: 10.1104/pp.107.108456
Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2009 · DOI: 10.1038/emboj.2009.4
UVR8 in Arabidopsis thaliana regulates multiple aspects of cellular differentiation during leaf development in response to ultraviolet B radiation.2009 · DOI: 10.1111/j.1469-8137.2009.02855.x
Negative feedback regulation of UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2010 · DOI: 10.1073/pnas.0914532107
Functional interaction of the circadian clock and UV RESISTANCE LOCUS 8-controlled UV-B signaling pathways in Arabidopsis thaliana.2011 · DOI: 10.1111/j.1365-313x.2011.04573.x
Perception of UV-B by the Arabidopsis UVR8 protein.2011 · DOI: 10.1126/science.1200660
UVR8 mediates UV-B-induced Arabidopsis defense responses against Botrytis cinerea by controlling sinapate accumulation.2012 · DOI: 10.1093/mp/sss025
C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein.2012 · DOI: 10.1073/pnas.1210898109
In vivo function of tryptophans in the Arabidopsis UV-B photoreceptor UVR8.2012 · DOI: 10.1105/tpc.112.101451
The UV-B photoreceptor UVR8 promotes photosynthetic efficiency in Arabidopsis thaliana exposed to elevated levels of UV-B.2012 · DOI: 10.1007/s11120-012-9785-y

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_031244 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009411 response to UV Biological Process
GO:0009649 entrainment of circadian clock Biological Process
GO:0010224 response to UV-B Biological Process
GO:0010374 stomatal complex development Biological Process
GO:0000785 chromatin Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009536 plastid Cellular Component
GO:0003682 chromatin binding Molecular Function
GO:0005085 guanyl-nucleotide exchange factor activity Molecular Function
KEGG gene cross-reference
ath:AT1G76950
ath:AT5G63860
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.483
Rank 1 · TkA07G362650 · TK1151
Cell membrane0.296
Rank 2 · TkA07G362650 · TK1151
Nucleus0.242
Rank 3 · TkA07G362650 · TK1151
Golgi apparatus0.093
Rank 4 · TkA07G362650 · TK1151
Lysosome / Vacuole0.061
Rank 5 · TkA07G362650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16457PH_1215-123 aa
PF25390WD40_RLD222-466 aa
PF13540RCC1_2236-247 aa
PF00415RCC1276-305 aa
PF25390WD40_RLD278-631 aa
PF13540RCC1_2294-319 aa
PF00415RCC1309-358 aa
PF25384Alsin_RLD310-421 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G362650PF16457PH_12151239e-1039.8
TkA07G362650PF25390WD40_RLD2224663.1e-112376.2
TkA07G362650PF13540RCC1_22362471.7e-33114.2
TkA07G362650PF00415RCC12763053.8e-79261.8
TkA07G362650PF25390WD40_RLD2786313.1e-112376.2
TkA07G362650PF13540RCC1_22943191.7e-33114.2
TkA07G362650PF00415RCC13093583.8e-79261.8
TkA07G362650PF25384Alsin_RLD3104216.9e-1142.6
TkA07G362650PF13540RCC1_23473721.7e-33114.2
TkA07G362650PF00415RCC13614133.8e-79261.8
TkA07G362650PF13540RCC1_24004281.7e-33114.2
TkA07G362650PF00415RCC14174653.8e-79261.8
TkA07G362650PF25384Alsin_RLD4174956.9e-1142.6
TkA07G362650PF13540RCC1_24534651.7e-33114.2
TkA07G362650PF13540RCC1_24784901.7e-33114.2
TkA07G362650PF00415RCC14795273.8e-79261.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q947D2Arabidopsis thalianasp|Q947D2|PRAF1_ARATH PH, RCC1 and FYVE domains-containing protein 165.600%Swiss-ProtHigh
Q9FN03Arabidopsis thalianasp|Q9FN03|UVR8_ARATH Ultraviolet-B receptor UVR834.000%Swiss-ProtLow

JBrowse

View in Genome Browser