LXL04_031244 | RubberDandelionOmics

Gene overview

LXL04_031244

Reference: OH-1004 Chr: Chr07 Coordinates: 3083285-3087976 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3203 bp · LXL04_031244|LXL04_031244|OH1004|cDNA

ATGGTAGTGGCCGGACGAGAGTGTGTGATTTCGATTGATAATGACCGGAGATTACAGCGGCGTCTGGCGGCGGTGCTGGTGGTGGTCCGGTGAATTCGTCACATGGAATGGCAGATCTTGTTAGCTACGGTAACGCCGATCGTGACATTGAGCAGGCATTAATTGCTCTGAAGAAGGGCGCACAGTTACTTAAATATGGTCGCAAGGGGAAGCCAAAATTTTGTCCATTTAGACTTTCCCATGATGAATCATCTCTAATT...

CDS

Download CDS FASTA

3096 bp · LXL04_031244|LXL04_031244|OH1004|CDS

ATGGCAGATCTTGTTAGCTACGGTAACGCCGATCGTGACATTGAGCAGGCATTAATTGCTCTGAAGAAGGGCGCACAGTTACTTAAATATGGTCGCAAGGGGAAGCCAAAATTTTGTCCATTTAGACTTTCCCATGATGAATCATCTCTAATTTGGATTTCGGGCAGTGGTGAAAGCAGCCTGAAATTAGCCTCAGTTTCTAGAATTATTCCTGGACAAAGAACTGCTGTTTTCAGGCGTTATCTGCGCCCTGAAAAAGA...

Protein

Download Protein FASTA

1031 aa · LXL04_031244|LXL04_031244|OH1004|PROTEIN

MADLVSYGNADRDIEQALIALKKGAQLLKYGRKGKPKFCPFRLSHDESSLIWISGSGESSLKLASVSRIIPGQRTAVFRRYLRPEKDYLSFSLIYNNGKRSLDLICKDKVEAEVWIAGLKALISSWQGGRSKIDGWSDGGLYLDDNKDLASNSASDSSITPDVSVSSKTSSNFDKPHAITDNPNMQIKNGSNSDAFRVSVSSAPSTSSHGSGPDDCDALGDVYIWGEVICENTIKLNPTQTLTRTDILLPKPLESNLVLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_031244`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_031244

Location Chr07:3083285-3087976 (+)

Description Similar to PRAF1: PH, RCC1 and FYVE domains-containing protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g76950`	Binds to phosphatidic acid and to phosphoinositides such as PtdIns3P, PtdIns(3,4)P(2), PtdIns(3,4,5)P(3) and PtdIns(4,5)P(2).	No verified direct reference in this release
`At5g63860`	UV-B specific signaling component that acts as a UV-B photoreceptor and plays a key role in establishing UV-protective responses in plants.	A UV-B-specific signaling component orchestrates plant UV protection.2005 · DOI: 10.1073/pnas.0507187102 UV-B promotes rapid nuclear translocation of the Arabidopsis UV-B specific signaling component UVR8 and activates its function in the nucleus.2007 · DOI: 10.1105/tpc.107.053330 UV-B signaling pathways with different fluence-rate response profiles are distinguished in mature Arabidopsis leaf tissue by requirement for UVR8, HY5, and HYH.2008 · DOI: 10.1104/pp.107.108456 Interaction of COP1 and UVR8 regulates UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2009 · DOI: 10.1038/emboj.2009.4 UVR8 in Arabidopsis thaliana regulates multiple aspects of cellular differentiation during leaf development in response to ultraviolet B radiation.2009 · DOI: 10.1111/j.1469-8137.2009.02855.x Negative feedback regulation of UV-B-induced photomorphogenesis and stress acclimation in Arabidopsis.2010 · DOI: 10.1073/pnas.0914532107 Functional interaction of the circadian clock and UV RESISTANCE LOCUS 8-controlled UV-B signaling pathways in Arabidopsis thaliana.2011 · DOI: 10.1111/j.1365-313x.2011.04573.x Perception of UV-B by the Arabidopsis UVR8 protein.2011 · DOI: 10.1126/science.1200660 UVR8 mediates UV-B-induced Arabidopsis defense responses against Botrytis cinerea by controlling sinapate accumulation.2012 · DOI: 10.1093/mp/sss025 C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein.2012 · DOI: 10.1073/pnas.1210898109 In vivo function of tryptophans in the Arabidopsis UV-B photoreceptor UVR8.2012 · DOI: 10.1105/tpc.112.101451 The UV-B photoreceptor UVR8 promotes photosynthetic efficiency in Arabidopsis thaliana exposed to elevated levels of UV-B.2012 · DOI: 10.1007/s11120-012-9785-y

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031244 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009411 response to UV Biological Process

GO:0009649 entrainment of circadian clock Biological Process

GO:0010224 response to UV-B Biological Process

GO:0010374 stomatal complex development Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0003682 chromatin binding Molecular Function

GO:0005085 guanyl-nucleotide exchange factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G76950

ath:AT5G63860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.485

Rank 1 · LXL04_031244 · OH-1004

Cell membrane0.312

Rank 2 · LXL04_031244 · OH-1004

Nucleus0.251

Rank 3 · LXL04_031244 · OH-1004

Golgi apparatus0.087

Rank 4 · LXL04_031244 · OH-1004

Lysosome / Vacuole0.059

Rank 5 · LXL04_031244 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16457.12PH_1215-123 aa

PF25390.2WD40_RLD222-599 aa

PF13540.13RCC1_2262-287 aa

PF25384.2Alsin_RLD273-389 aa

PF00415.25RCC1277-326 aa

PF13540.13RCC1_2313-340 aa

PF00415.25RCC1330-381 aa

PF13540.13RCC1_2368-396 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_031244	`PF16457.12`	PH_12	15	123	4e-09	37.7
LXL04_031244	`PF25390.2`	WD40_RLD	222	599	6.8e-78	263.2
LXL04_031244	`PF13540.13`	RCC1_2	262	287	4.7e-34	116.0
LXL04_031244	`PF25384.2`	Alsin_RLD	273	389	7e-13	49.2
LXL04_031244	`PF00415.25`	RCC1	277	326	8.5e-83	273.5
LXL04_031244	`PF13540.13`	RCC1_2	313	340	4.7e-34	116.0
LXL04_031244	`PF00415.25`	RCC1	330	381	8.5e-83	273.5
LXL04_031244	`PF13540.13`	RCC1_2	368	396	4.7e-34	116.0
LXL04_031244	`PF00415.25`	RCC1	384	433	8.5e-83	273.5
LXL04_031244	`PF00415.25`	RCC1	447	496	8.5e-83	273.5
LXL04_031244	`PF13540.13`	RCC1_2	484	512	4.7e-34	116.0
LXL04_031244	`PF00415.25`	RCC1	499	548	8.5e-83	273.5
LXL04_031244	`PF13540.13`	RCC1_2	536	563	4.7e-34	116.0
LXL04_031244	`PF00415.25`	RCC1	553	600	8.5e-83	273.5
LXL04_031244	`PF01363.28`	FYVE	604	670	5.9e-15	55.9
LXL04_031244	`PF13713.12`	BRX_N	847	881	1.7e-17	63.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q947D2`	Arabidopsis thaliana	PH, RCC1 and FYVE domains-containing protein 1	66.395%	Swiss-Prot	strong database homology
`Q9FN03`	Arabidopsis thaliana	Ultraviolet-B receptor UVR8	34.579%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card