TkA07G358390 | RubberDandelionOmics

Gene overview

TkA07G358390

Reference: TK1151 Chr: Chr07 Coordinates: 89769535-89772717 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1885 bp · TkA07G358390|TK1151|cDNA

GTTTATTTACAAGTGTTACCTCTATCAAAACAAAATTTTGTTTTCGATTCTTGTCCGCCTCTTTTTTGGCCTTTGGAGATAGGATTAGTCGCATTTCCTACTTTGAGTCTTTGATTGGTCCCTGACACCTCGCTCCTAACTCTTCTGATTCTCAACTTTTGATCAAAATCCAATTTCAATGGCGGCTAACTGTTCGTCTCTAACACCGTCGCCAATGGCTCTTTCCGGTGGCTCCACCACCTCCTCCGCCGCTCCTCGTC...

CDS

Download CDS FASTA

1146 bp · TkA07G358390|TK1151|CDS

ATGGCGGCTAACTGTTCGTCTCTAACACCGTCGCCAATGGCTCTTTCCGGTGGCTCCACCACCTCCTCCGCCGCTCCTCGTCTTCTTTCACTTTCACCAACTACCACCGCCAGAGCTTCATCCCTCTCATTCCACATCCTCTCCTCCTCCTCTTCCATCGCTGCTTCACTCAAATCTCTCAAATTATCTCATCAGAAACGAACAAAGCTTCATTGCTCCAGTGGTGATTTCGCCGCAGTGGTTACCACAAAATGCGTTGC...

Protein

Download Protein FASTA

381 aa · TkA07G358390|TK1151|PROTEIN

MAANCSSLTPSPMALSGGSTTSSAAPRLLSLSPTTTARASSLSFHILSSSSSIAASLKSLKLSHQKRTKLHCSSGDFAAVVTTKCVASNPDQLVSAREDIKDLLKATYCHPIMVRLGWHDAGTYNKNIEEWPQRGGANGSLRFDVEQKHAANAGLVNALKLLQPIKDKYTNVTYADLFQLASATAIEQAGGPKIPMKYGRVDVSGPEQCPEEGRLPDAGPPSPASHLRDVFYRMGLNDKDIVALSGAHTLGRSRPERSGW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G358390`
TK1151 ID	TkA07G358390
OH-1004 ID	LXL04_029902
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	89.400
Protein coverage (%)	TK1151 99.738 / OH-1004 88.662 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G358390

Location Chr07:89769535-89772717 (-)

Description Similar to APXT: L-ascorbate peroxidase T, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g77490`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release
`At4g08390`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0553200`	Involved in defense response and tolerance to the bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo).	The rice thylakoid membrane-bound ascorbate peroxidase OsAPX8 functions in tolerance to bacterial blight.2016 · DOI: 10.1038/srep26104
`Os04g0434800`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release
`Os12g0178100`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029902 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006952 defense response Biological Process

GO:0009631 cold acclimation Biological Process

GO:0010019 chloroplast-nucleus signaling pathway Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0071588 hydrogen peroxide mediated signaling pathway Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT1G77490

ath:AT4G08390

dosa:Os02g0553200

dosa:Os04g0434800

dosa:Os12g0178100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.960

Rank 1 · TkA07G358390 · TK1151

Mitochondrion0.062

Rank 2 · TkA07G358390 · TK1151

Cytoplasm0.021

Rank 3 · TkA07G358390 · TK1151

Nucleus0.016

Rank 4 · TkA07G358390 · TK1151

Cell membrane0.013

Rank 5 · TkA07G358390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11555Inhibitor_Mig-66-38 aa

PF00141peroxidase97-328 aa

PF27604PB2B2_08143-182 aa

PF22147AcrIC5322-342 aa

PF08132AdoMetDC_leader354-377 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G358390	`PF11555`	Inhibitor_Mig-6	6	38	4.5	8.5
TkA07G358390	`PF00141`	peroxidase	97	328	1.6e-46	159.8
TkA07G358390	`PF27604`	PB2B2_08	143	182	0.093	13.3
TkA07G358390	`PF22147`	AcrIC5	322	342	0.28	12.1
TkA07G358390	`PF08132`	AdoMetDC_leader	354	377	0.2	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42593`	Arabidopsis thaliana	sp\|Q42593\|APXT_ARATH L-ascorbate peroxidase T, chloroplastic	79.500%	Swiss-Prot	High
`Q42592`	Arabidopsis thaliana	sp\|Q42592\|APXS_ARATH L-ascorbate peroxidase S, chloroplastic/mitochondrial	81.100%	Swiss-Prot	High
`Q69SV0`	Oryza sativa subsp. japonica	sp\|Q69SV0\|APX8_ORYSJ Probable L-ascorbate peroxidase 8, chloroplastic	83.200%	Swiss-Prot	High
`Q7XJ02`	Oryza sativa subsp. japonica	sp\|Q7XJ02\|APX7_ORYSJ Probable L-ascorbate peroxidase 7, chloroplastic	81.800%	Swiss-Prot	High
`P0C0L1`	Oryza sativa subsp. japonica	sp\|P0C0L1\|APX6_ORYSJ Probable L-ascorbate peroxidase 6, chloroplastic/mitochondrial	82.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card