LXL04_029902 | RubberDandelionOmics

Gene overview

LXL04_029902

Reference: OH-1004 Chr: Chr06 Coordinates: 103056758-103059473 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1326 bp · LXL04_029902|LXL04_029902|OH1004|cDNA

ATGGCGGCTAACTGTTCGTCTCTAACACCGTCGCCAATGGCTCTTTCCGGTGGCTCCACCACCTCCTCCGCCGCTCCTCGTCTTCTTTCACTTTCACCAACTACCACCGCCAGAGCTTCATCCCTCTCATTCCACATCCTCTCCTCCTCCTCTTCCATCGCTGCTTCACTCAAATCTCTCAAATTATCTCATCAGGTTTCGTTTCGCTCCATTCCGTTCCTCATTCATTACAAATGTTTTGCTTATTCTCATTATCTCGA...

CDS

Download CDS FASTA

1326 bp · LXL04_029902|LXL04_029902|OH1004|CDS

ATGGCGGCTAACTGTTCGTCTCTAACACCGTCGCCAATGGCTCTTTCCGGTGGCTCCACCACCTCCTCCGCCGCTCCTCGTCTTCTTTCACTTTCACCAACTACCACCGCCAGAGCTTCATCCCTCTCATTCCACATCCTCTCCTCCTCCTCTTCCATCGCTGCTTCACTCAAATCTCTCAAATTATCTCATCAGGTTTCGTTTCGCTCCATTCCGTTCCTCATTCATTACAAATGTTTTGCTTATTCTCATTATCTCGA...

Protein

Download Protein FASTA

441 aa · LXL04_029902|LXL04_029902|OH1004|PROTEIN

MAANCSSLTPSPMALSGGSTTSSAAPRLLSLSPTTTARASSLSFHILSSSSSIAASLKSLKLSHQVSFRSIPFLIHYKCFAYSHYLDLLQKRTKLHCSSGDFAAVVTTKCVASNPDQLVSAREDIKDLLKATYCHPVMVRLGWHDAGTYNKNIEEWPQRGGANGRLVNALKLLQPIKDKYTNVTYADLFQLASATAIEQAGGPKIPMKYGRVDVSAPEQCPEEGRLPDAGPPSPASHLRDVFYRMGLNDKDIVALSGAHT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029902`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029902

Location Chr06:103056758-103059473 (-)

Description Similar to APXT: L-ascorbate peroxidase T, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g77490`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release
`At4g08390`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0553200`	Involved in defense response and tolerance to the bacterial pathogen Xanthomonas oryzae pv. oryzae (Xoo).	The rice thylakoid membrane-bound ascorbate peroxidase OsAPX8 functions in tolerance to bacterial blight.2016 · DOI: 10.1038/srep26104
`Os04g0434800`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release
`Os12g0178100`	Plays a key role in hydrogen peroxide removal.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029902 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006952 defense response Biological Process

GO:0009631 cold acclimation Biological Process

GO:0010019 chloroplast-nucleus signaling pathway Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0042744 hydrogen peroxide catabolic process Biological Process

GO:0071588 hydrogen peroxide mediated signaling pathway Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009534 chloroplast thylakoid Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT1G77490

ath:AT4G08390

dosa:Os02g0553200

dosa:Os04g0434800

dosa:Os12g0178100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.962

Rank 1 · LXL04_029902 · OH-1004

Mitochondrion0.047

Rank 2 · LXL04_029902 · OH-1004

Cytoplasm0.024

Rank 3 · LXL04_029902 · OH-1004

Nucleus0.017

Rank 4 · LXL04_029902 · OH-1004

Cell membrane0.017

Rank 5 · LXL04_029902 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00141.29peroxidase122-339 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029902	`PF00141.29`	peroxidase	122	339	1.4e-38	133.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42593`	Arabidopsis thaliana	L-ascorbate peroxidase T, chloroplastic	73.458%	Swiss-Prot	strong database homology
`Q42592`	Arabidopsis thaliana	L-ascorbate peroxidase S, chloroplastic/mitochondrial	73.559%	Swiss-Prot	moderate database homology
`Q69SV0`	Oryza sativa subsp. japonica	Probable L-ascorbate peroxidase 8, chloroplastic	68.638%	Swiss-Prot	strong database homology
`Q7XJ02`	Oryza sativa subsp. japonica	Probable L-ascorbate peroxidase 7, chloroplastic	76.866%	Swiss-Prot	moderate database homology
`P0C0L1`	Oryza sativa subsp. japonica	Probable L-ascorbate peroxidase 6, chloroplastic/mitochondrial	77.985%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card