TkA07G355400 | RubberDandelionOmics

Gene overview

TkA07G355400

Reference: TK1151 Chr: Chr07 Coordinates: 88943870-88948673 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2587 bp · TkA07G355400|TK1151|cDNA

AACTGTATGCCAGAGTGGCGCCCTGCAACAGTATTTTTCCAGCTGTTTTCCACAATGGAAACGTATATATATCTAAGAGATAGATTCGGGAACCTTGTCCCAGAGTTTTATGATTTTGAGTTTGAAGTTATTGACACGTATACAGGTTTGGCTTTACCTATTGGAGATATAAAATTCGAGAAGGTAGTTCCGGGTATTCAGTTACTTTCCTTCAAGCTACCTACACCAGGGCAGCGTGTACTCACCATTACAGATAAGGA...

CDS

Download CDS FASTA

2496 bp · TkA07G355400|TK1151|CDS

ATGCCAGAGTGGCGCCCTGCAACAGTATTTTTCCAGCTGTTTTCCACAATGGAAACGTATATATATCTAAGAGATAGATTCGGGAACCTTGTCCCAGAGTTTTATGATTTTGAGTTTGAAGTTATTGACACGTATACAGGTTTGGCTTTACCTATTGGAGATATAAAATTCGAGAAGGTAGTTCCGGGTATTCAGTTACTTTCCTTCAAGCTACCTACACCAGGGCAGCGTGTACTCACCATTACAGATAAGGATAAGAA...

Protein

Download Protein FASTA

831 aa · TkA07G355400|TK1151|PROTEIN

MPEWRPATVFFQLFSTMETYIYLRDRFGNLVPEFYDFEFEVIDTYTGLALPIGDIKFEKVVPGIQLLSFKLPTPGQRVLTITDKDKKTGILNTPFRFTIFIAYCDGLRSIVNGSGLHNSIAGESSKFTILLRDAYQYPSPLELHSLRVQITLPAQSLNVEAHIFPIDSINGTQNVGAFDPSVPSDYLQPDGFWKIWQSAYEVEYVAEKMGWYEISVFSGNVQLNDGKPFTKFVRGSGVVDISTSRVVKYEKAVINLVVQG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G355400`
TK1151 ID	TkA07G355400
OH-1004 ID	LXL04_029873
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 68.812 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G355400

Location Chr07:88943870-88948673 (+)

Description Similar to GEX2: Protein GAMETE EXPRESSED 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g49150`	Protein GAMETE EXPRESSED 2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029873 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0030036 actin cytoskeleton organization Biological Process

GO:0048235 pollen sperm cell differentiation Biological Process

GO:0061936 fusion of sperm to egg plasma membrane involved in double fertilization forming a zygote and endosperm Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0051015 actin filament binding Molecular Function

KEGG gene cross-reference

ath:AT5G49150

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.475

Rank 1 · TkA07G355400 · TK1151

Cytoplasm0.240

Rank 2 · TkA07G355400 · TK1151

Endoplasmic reticulum0.145

Rank 3 · TkA07G355400 · TK1151

Lysosome / Vacuole0.142

Rank 4 · TkA07G355400 · TK1151

Golgi apparatus0.132

Rank 5 · TkA07G355400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00630Filamin106-224 aa

PF00630Filamin297-334 aa

PF17963Big_9345-418 aa

PF17803Cadherin_4346-427 aa

PF17892Cadherin_5382-422 aa

PF28974GEX2394-418 aa

PF28974GEX2456-556 aa

PF17963Big_9525-549 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G355400	`PF00630`	Filamin	106	224	8.3e-12	46.5
TkA07G355400	`PF00630`	Filamin	297	334	8.3e-12	46.5
TkA07G355400	`PF17963`	Big_9	345	418	1.8e-09	39.1
TkA07G355400	`PF17803`	Cadherin_4	346	427	2.7e-06	28.5
TkA07G355400	`PF17892`	Cadherin_5	382	422	2.2e-05	24.9
TkA07G355400	`PF28974`	GEX2	394	418	2.3e-42	143.6
TkA07G355400	`PF28974`	GEX2	456	556	2.3e-42	143.6
TkA07G355400	`PF17963`	Big_9	525	549	1.8e-09	39.1
TkA07G355400	`PF17803`	Cadherin_4	526	551	2.7e-06	28.5
TkA07G355400	`PF17803`	Cadherin_4	577	614	2.7e-06	28.5
TkA07G355400	`PF28974`	GEX2	627	693	2.3e-42	143.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4K4R6`	Arabidopsis thaliana	sp\|F4K4R6\|GEX2_ARATH Protein GAMETE EXPRESSED 2	44.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card