TkA07G352370 | RubberDandelionOmics

Gene overview

TkA07G352370

Reference: TK1151 Chr: Chr07 Coordinates: 88089139-88090260 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

975 bp · TkA07G352370|TK1151|cDNA

ATGTCGGCCGCCGCCGGACAGAAGACTGTACGGAAGTTTCCACCGCCGTGCTGGACGCGGGATGAGGCACTGGTTCTGATCGAAGCATACCGTGAGCGATGGTACGCGCTTCACCGTGCGTTCCTCCGCACGCCGGACTGGGACGCGGTGGCGGAGAAAGTAACAACCAGCTGCCCGGACGTCATGCCGCCGAAAACCTCCGCTCAGTGCCGCCACAAGATGGAAAAGCTCCGTCAACGCCACCGAGCCGAGAAGCAGCG...

CDS

Download CDS FASTA

975 bp · TkA07G352370|TK1151|CDS

ATGTCGGCCGCCGCCGGACAGAAGACTGTACGGAAGTTTCCACCGCCGTGCTGGACGCGGGATGAGGCACTGGTTCTGATCGAAGCATACCGTGAGCGATGGTACGCGCTTCACCGTGCGTTCCTCCGCACGCCGGACTGGGACGCGGTGGCGGAGAAAGTAACAACCAGCTGCCCGGACGTCATGCCGCCGAAAACCTCCGCTCAGTGCCGCCACAAGATGGAAAAGCTCCGTCAACGCCACCGAGCCGAGAAGCAGCG...

Protein

Download Protein FASTA

324 aa · TkA07G352370|TK1151|PROTEIN

MSAAAGQKTVRKFPPPCWTRDEALVLIEAYRERWYALHRAFLRTPDWDAVAEKVTTSCPDVMPPKTSAQCRHKMEKLRQRHRAEKQRASAFSGERFFSSWFYFEAMEAMENGYNTEPGSNPQINSEIHNPHGLNPGRGLRFKPLADDGSNQEDDDEDGCLVETPIEETKYKGHQDAFLVDTSIREAKNHKTSSISARPDLRPRKFSKVVHDDEDADNGRMWIKVPRNTNKSTGRHEHPNGKESTKGKKKKGGLSEVVSSI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G352370`
TK1151 ID	TkA07G352370
OH-1004 ID	LXL04_029843
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	80.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G352370`
Location	Chr07:88089139-88090260 (-)
Description	Similar to FIP2: Protein FIP2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029843` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0009873 ethylene-activated signaling pathway Biological Process GO:0010468 regulation of gene expression Biological Process GO:0040029 epigenetic regulation of gene expression Biological Process GO:0000325 plant-type vacuole Cellular Component GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0000976 transcription cis-regulatory region binding Molecular Function GO:0003682 chromatin binding Molecular Function GO:0003700 DNA-binding transcription factor activity Molecular Function GO:0042393 histone binding Molecular Function
KEGG gene cross-reference	ath:AT3G11100 ath:AT3G14180 ath:AT4G17060 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.980

Rank 1 · TkA07G352370 · TK1151

Cytoplasm0.055

Rank 2 · TkA07G352370 · TK1151

Cell membrane0.022

Rank 3 · TkA07G352370 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA07G352370 · TK1151

Plastid0.010

Rank 5 · TkA07G352370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13837Myb_DNA-bind_416-109 aa

PF00249Myb_DNA-binding17-73 aa

PF10545MADF_DNA_bdg42-108 aa

PF15377DUF4604158-254 aa

PF10545MADF_DNA_bdg269-291 aa

PF29763Phasin_PhaP274-309 aa

PF13837Myb_DNA-bind_4278-285 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G352370	`PF13837`	Myb_DNA-bind_4	16	109	2.3e-13	51.1
TkA07G352370	`PF00249`	Myb_DNA-binding	17	73	0.1	13.5
TkA07G352370	`PF10545`	MADF_DNA_bdg	42	108	1.3e-07	32.6
TkA07G352370	`PF15377`	DUF4604	158	254	0.22	12.6
TkA07G352370	`PF10545`	MADF_DNA_bdg	269	291	1.3e-07	32.6
TkA07G352370	`PF29763`	Phasin_PhaP	274	309	0.081	13.8
TkA07G352370	`PF13837`	Myb_DNA-bind_4	278	285	2.3e-13	51.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card