RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G350920
Reference: TK1151 Chr: Chr07 Coordinates: 87677920-87679533 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1614 bp · TkA07G350920|TK1151|cDNA

ATGATGCAGATCGGTGCAACACTTCCGGCGAACAATATTCACATGTTTCAGGGAAGACACTTTTCCGGTGGCTTTAGTTATAGGTCATCGTTGAATCCTTCTGGAAGAGAGCGTTCCACGAAGAACATGATGAAAGCCACCACCGTGTCGGCCGCCGTATCAACCCGCCAACACATCTCTAATCTTGACAAATTACTCGGTACAGAAGTACCGCAGGTGATTCTGACTGAGCCGGAACTCGCTAAGGAGGATATTTCCGA...

CDS

Download CDS FASTA

1614 bp · TkA07G350920|TK1151|CDS

ATGATGCAGATCGGTGCAACACTTCCGGCGAACAATATTCACATGTTTCAGGGAAGACACTTTTCCGGTGGCTTTAGTTATAGGTCATCGTTGAATCCTTCTGGAAGAGAGCGTTCCACGAAGAACATGATGAAAGCCACCACCGTGTCGGCCGCCGTATCAACCCGCCAACACATCTCTAATCTTGACAAATTACTCGGTACAGAAGTACCGCAGGTGATTCTGACTGAGCCGGAACTCGCTAAGGAGGATATTTCCGA...

Protein

Download Protein FASTA

537 aa · TkA07G350920|TK1151|PROTEIN

MMQIGATLPANNIHMFQGRHFSGGFSYRSSLNPSGRERSTKNMMKATTVSAAVSTRQHISNLDKLLGTEVPQVILTEPELAKEDISDHESLDNRGKGLLGGLNLSQIWPENKAAEEMSPRHLNRLRRLLSKNGIEYSPRNSLASRWREYHGSNNWSGLLDPLDENLRREMIRYGEFIQAAYHCFHSDPATSAYEAPSPRHVALPDKSYRVTKNLYATSSVGLPKWVDKLAPGLDWMSQRSSCIGYVAVCDDQREIARMGR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G350920
TK1151 IDTkA07G350920
OH-1004 IDLXL04_029828
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.800
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G350920
LocationChr07:87677920-87679533 (+)
DescriptionSimilar to At4g16820: Phospholipase A1-Ibeta2, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g16820 Acylhydrolase that catalyzes the hydrolysis of phosphatidylcholine at the sn-1 position. No verified direct reference in this release
At2g44810 Sn-1-specific phospholipase that releases free fatty acids from phospholipids. No verified direct reference in this release
At1g51440 Acylhydrolase that catalyzes the hydrolysis of phosphatidylcholine at the sn-1 position. No verified direct reference in this release
At1g06800 Acylhydrolase with a broad specificity.
DONGLE and DEFECTIVE IN ANTHER DEHISCENCE1 lipases are not essential for wound- and pathogen-induced jasmonate biosynthesis: redundant lipases contribute to jasmonate formation.2010 · DOI: 10.1104/pp.110.155093
At2g30550 Acylhydrolase with broad specificity. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_029828 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009611 response to wounding Biological Process
GO:0009695 jasmonic acid biosynthetic process Biological Process
GO:0009901 anther dehiscence Biological Process
GO:0010152 pollen maturation Biological Process
GO:0016042 lipid catabolic process Biological Process
GO:0043068 positive regulation of programmed cell death Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0004620 glycerophospholipase activity Molecular Function
GO:0004806 triacylglycerol lipase activity Molecular Function
GO:0008970 glycerophospholipid phospholipase A1 activity Molecular Function
KEGG gene cross-reference
ath:AT1G06800
ath:AT1G51440
ath:AT2G30550
ath:AT2G44810
ath:AT4G16820
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.974
Rank 1 · TkA07G350920 · TK1151
Mitochondrion0.037
Rank 2 · TkA07G350920 · TK1151
Cytoplasm0.030
Rank 3 · TkA07G350920 · TK1151
Nucleus0.023
Rank 4 · TkA07G350920 · TK1151
Peroxisome0.020
Rank 5 · TkA07G350920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12697Abhydrolase_6212-254 aa
PF11187Mbeg1-like258-280 aa
PF01764Lipase_3264-411 aa
PF05057DUF676313-396 aa
PF12146Hydrolase_4314-358 aa
PF12697Abhydrolase_6316-367 aa
PF00975Thioesterase319-360 aa
PF07819PGAP1319-356 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G350920PF12697Abhydrolase_62122540.03115.6
TkA07G350920PF11187Mbeg1-like2582800.1312.4
TkA07G350920PF01764Lipase_32644116.5e-34117.5
TkA07G350920PF05057DUF6763133960.06313.5
TkA07G350920PF12146Hydrolase_43143580.3211.0
TkA07G350920PF12697Abhydrolase_63163670.03115.6
TkA07G350920PF00975Thioesterase3193600.1712.8
TkA07G350920PF07819PGAP13193560.3411.3
TkA07G350920PF11187Mbeg1-like3233790.1312.4
TkA07G350920PF06259Abhydrolase_83264100.05713.8
TkA07G350920PF11187Mbeg1-like5025230.1312.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O23522Arabidopsis thalianasp|O23522|PLA14_ARATH Phospholipase A1-Ibeta2, chloroplastic59.600%Swiss-ProtHigh
Q948R1Arabidopsis thalianasp|Q948R1|PLA11_ARATH Phospholipase A(1) DAD1, chloroplastic51.600%Swiss-ProtMedium
Q9C8J6Arabidopsis thalianasp|Q9C8J6|PLA17_ARATH Phospholipase A1-Igamma3, chloroplastic44.400%Swiss-ProtMedium
Q941F1Arabidopsis thalianasp|Q941F1|PLA15_ARATH Phospholipase A1-Igamma1, chloroplastic41.200%Swiss-ProtMedium
Q3EBR6Arabidopsis thalianasp|Q3EBR6|PLA16_ARATH Phospholipase A1-Igamma2, chloroplastic40.400%Swiss-ProtMedium

JBrowse

View in Genome Browser