TkA07G310530 | RubberDandelionOmics

Gene overview

TkA07G310530

Reference: TK1151 Chr: Chr07 Coordinates: 77968435-77971455 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1320 bp · TkA07G310530|TK1151|cDNA

ATAAAATGAGACTATAAAGACTAACAATGTAACGATTCAAATAGTTGTCATGTTTTTTAATAACTAGACGAACTAATCTTGAAATTTTCTGTACTAAAAAAAGTAATACTTCAAAAAAACAAGAGAAAAGCAATTTTGTCTCCAAACTTTCTGCTCACCACCACGCAAGAGAGAAGTCTGGTTCAGCCATTGAGTGAAGACAACCCAAAAATGGCTTCATCGCTCTCGTACACTGCTGCCATTTCCAAACCACCTTCTTC...

CDS

Download CDS FASTA

900 bp · TkA07G310530|TK1151|CDS

ATGGCTTCATCGCTCTCGTACACTGCTGCCATTTCCAAACCACCTTCTTCACCTTCGCTAAATCCAAGAACTCTCTTCCTTTCTGGTACCCGTTCCTGTGTCTCAACCCCCATTTCTCACACCAATCGCTATGGTGGTGCAGGTGTAAAGGACACAAACTCCATGACAATAGATGTAGAAGCAGATATCAAGGCTGAGAGGCTTGTAGTGTTGGGAGGCAGTGGTTTTGTTGGTTCGGCTATATGCAAGGCTGCAGTATC...

Protein

Download Protein FASTA

299 aa · TkA07G310530|TK1151|PROTEIN

MASSLSYTAAISKPPSSPSLNPRTLFLSGTRSCVSTPISHTNRYGGAGVKDTNSMTIDVEADIKAERLVVLGGSGFVGSAICKAAVSRGIEVISLSRSGRPTSLDSWEDQVTWITGDVFYVNWDEVLPGATTVISTLGGFGSEEQMQRINGEANIIAVNAAKEYGIPKFILISVHDYNLPSFLLSSGYFTGKRKAESELLSKYPSSGVILRPGFIYGKRKVGNYEIPLDVIGEPVERLLNATASFTKPLNALPASDLILA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G310530`
TK1151 ID	TkA07G310530
OH-1004 ID	LXL04_029405
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 89.275 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G310530

Location Chr07:77968435-77971455 (+)

Description Similar to At1g32220: Uncharacterized protein At1g32220, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32220`	Uncharacterized protein At1g32220, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029405 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0051170 import into nucleus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0044877 protein-containing complex binding Molecular Function

KEGG gene cross-reference

ath:AT1G32220

dha:DEHA2F15070g

sce:YLR290C

spo:2538806

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.985

Rank 1 · TkA07G310530 · TK1151

Mitochondrion0.025

Rank 2 · TkA07G310530 · TK1151

Cytoplasm0.016

Rank 3 · TkA07G310530 · TK1151

Nucleus0.015

Rank 4 · TkA07G310530 · TK1151

Peroxisome0.011

Rank 5 · TkA07G310530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05368NmrA66-174 aa

PF04321RmlD_sub_bind67-105 aa

PF01370Epimerase69-219 aa

PF010733Beta_HSD69-175 aa

PF16363GDP_Man_Dehyd70-103 aa

PF13460NAD_binding_1072-224 aa

PF08732HIM1132-220 aa

PF04321RmlD_sub_bind194-220 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G310530	`PF05368`	NmrA	66	174	3.8e-06	27.4
TkA07G310530	`PF04321`	RmlD_sub_bind	67	105	0.079	12.7
TkA07G310530	`PF01370`	Epimerase	69	219	4.1e-08	33.6
TkA07G310530	`PF01073`	3Beta_HSD	69	175	3.8e-05	23.6
TkA07G310530	`PF16363`	GDP_Man_Dehyd	70	103	0.16	12.1
TkA07G310530	`PF13460`	NAD_binding_10	72	224	1.6e-12	48.4
TkA07G310530	`PF08732`	HIM1	132	220	0.069	13.4
TkA07G310530	`PF04321`	RmlD_sub_bind	194	220	0.079	12.7
TkA07G310530	`PF01073`	3Beta_HSD	208	219	3.8e-05	23.6
TkA07G310530	`PF01073`	3Beta_HSD	232	277	3.8e-05	23.6
TkA07G310530	`PF05368`	NmrA	252	280	3.8e-06	27.4
TkA07G310530	`PF13460`	NAD_binding_10	262	278	1.6e-12	48.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FVR6`	Arabidopsis thaliana	sp\|Q9FVR6\|Y1222_ARATH Uncharacterized protein At1g32220, chloroplastic	64.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card