LXL04_029405 | RubberDandelionOmics

Gene overview

LXL04_029405

Reference: OH-1004 Chr: Chr06 Coordinates: 89262181-89265154 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1038 bp · LXL04_029405|LXL04_029405|OH1004|cDNA

ATGAGTAATACTTTAAAAAACAGGAGAAAAGCAAATTTGTCTCCAAACTTTCTGCTCACCACCACGCAAGAGAGAAGTCTGGTTCAGCCATTGAGTGAAGACAACCCAAAAATGGCTTCATCGCTATCGTACACTGCTGCCATTTCCAAACCACCTTCTTCACCTTCGCTAAATTCAAGAACTCTCTTCCTTTCCGGTACCCGTTCGCGTGTCTCAACCCCCATTTCTCACACCAATCGCTGTTTGAGGCTTGGTGTCAA...

CDS

Download CDS FASTA

1038 bp · LXL04_029405|LXL04_029405|OH1004|CDS

ATGAGTAATACTTTAAAAAACAGGAGAAAAGCAAATTTGTCTCCAAACTTTCTGCTCACCACCACGCAAGAGAGAAGTCTGGTTCAGCCATTGAGTGAAGACAACCCAAAAATGGCTTCATCGCTATCGTACACTGCTGCCATTTCCAAACCACCTTCTTCACCTTCGCTAAATTCAAGAACTCTCTTCCTTTCCGGTACCCGTTCGCGTGTCTCAACCCCCATTTCTCACACCAATCGCTGTTTGAGGCTTGGTGTCAA...

Protein

Download Protein FASTA

345 aa · LXL04_029405|LXL04_029405|OH1004|PROTEIN

MSNTLKNRRKANLSPNFLLTTTQERSLVQPLSEDNPKMASSLSYTAAISKPPSSPSLNSRTLFLSGTRSRVSTPISHTNRCLRLGVKCSYGGAGVKDTNSMTIDVEADIKAERLVVLGGSGFVGSAICKAAVSRGIEVISLSRSGRPTSLDSWEDQVTWITGDVFYVNWDEVLPGATTVISTLGGFGSEEQMQRINGEANIIAVNAAKEYGIPKFILISVHDYNLPSFLLSSGYFTGKRKAESELLSKYPSSGVILRPGF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029405`
TK1151 ID	TkA07G310530
OH-1004 ID	LXL04_029405
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.400
Protein coverage (%)	TK1151 100.000 / OH-1004 89.275 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029405

Location Chr06:89262181-89265154 (+)

Description Similar to At1g32220: Uncharacterized protein At1g32220, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g32220`	Uncharacterized protein At1g32220, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029405 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0051170 import into nucleus Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0010287 plastoglobule Cellular Component

GO:0044877 protein-containing complex binding Molecular Function

KEGG gene cross-reference

ath:AT1G32220

dha:DEHA2F15070g

sce:YLR290C

spo:2538806

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.984

Rank 1 · LXL04_029405 · OH-1004

Mitochondrion0.025

Rank 2 · LXL04_029405 · OH-1004

Nucleus0.016

Rank 3 · LXL04_029405 · OH-1004

Cytoplasm0.016

Rank 4 · LXL04_029405 · OH-1004

Peroxisome0.011

Rank 5 · LXL04_029405 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05368.20NmrA112-220 aa

PF01370.28Epimerase115-265 aa

PF13460.13NAD_binding_10118-270 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029405	`PF05368.20`	NmrA	112	220	5.5e-06	26.9
LXL04_029405	`PF01370.28`	Epimerase	115	265	6.4e-08	33.0
LXL04_029405	`PF13460.13`	NAD_binding_10	118	270	2.4e-12	47.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FVR6`	Arabidopsis thaliana	Uncharacterized protein At1g32220, chloroplastic	63.487%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card