TkA07G307160 | RubberDandelionOmics

Gene overview

TkA07G307160

Reference: TK1151 Chr: Chr07 Coordinates: 77100760-77103492 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1377 bp · TkA07G307160|TK1151|cDNA

GAACAGAACAGAAGTTGCACAAAACATTAATAAACACACAGTCGGACACAGGGACGCCGTGAAATCGAGAAGAAAATGAAAAATATTCCGGTGATTCTTATGGGCTGCGGAGGCGTTGGGAGACAACTCCTTCAACACATCGTCTCTTGTCGAACCATACATGCAAACAAGGGAATTCACTTGCGAGTTGTTGGTGTATGCGATAGTAAGTCATTTCTTGTTGCAAAAGACGTGTTATCCATGGAGTTCAATGACACCTT...

CDS

Download CDS FASTA

1119 bp · TkA07G307160|TK1151|CDS

ATGAAAAATATTCCGGTGATTCTTATGGGCTGCGGAGGCGTTGGGAGACAACTCCTTCAACACATCGTCTCTTGTCGAACCATACATGCAAACAAGGGAATTCACTTGCGAGTTGTTGGTGTATGCGATAGTAAGTCATTTCTTGTTGCAAAAGACGTGTTATCCATGGAGTTCAATGACACCTTTTTGATGGACATTTGCAAAATCAAGTCAAACGGCATGTCCCTGCAAACATGTGTTGACTCTGGTAAATGTGAAGC...

Protein

Download Protein FASTA

372 aa · TkA07G307160|TK1151|PROTEIN

MKNIPVILMGCGGVGRQLLQHIVSCRTIHANKGIHLRVVGVCDSKSFLVAKDVLSMEFNDTFLMDICKIKSNGMSLQTCVDSGKCEAFSYSESSKKLTNIASSLAFTLVDCSASSETVKIITQAVNSGCCAVLANKKPLTSSMEDFNNLFLHPRRIRHESTVGAGLPIISSLNRILSSGDTIYRIIGSLSGTLGYVMSEVEDGKPFSEVVKAAQALGYTEPDPRDDLSGMDVARKGLILARLLGQRMDMSSIKIESLYPD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G307160`
TK1151 ID	TkA07G307160
OH-1004 ID	LXL04_029365
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G307160`
Location	Chr07:77100760-77103492 (-)
Description	Similar to Bifunctional aspartokinase/homoserine dehydrogenase, chloroplastic (Fragment)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029365` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009067 aspartate family amino acid biosynthetic process Biological Process GO:0009086 methionine biosynthetic process Biological Process GO:0009088 L-threonine biosynthetic process Biological Process GO:0009089 L-lysine biosynthetic process via diaminopimelate Biological Process GO:0009090 L-homoserine biosynthetic process Biological Process GO:0051289 protein homotetramerization Biological Process GO:0009507 chloroplast Cellular Component GO:0004072 aspartate kinase activity Molecular Function GO:0004412 homoserine dehydrogenase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0042802 identical protein binding Molecular Function GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference	bab:bbp_183 bas:BUsg_188 ecj:JW0001 eco:b0002 ecoc:C3026_00010 zma:542249 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.620

Rank 1 · TkA07G307160 · TK1151

Nucleus0.286

Rank 2 · TkA07G307160 · TK1151

Mitochondrion0.147

Rank 3 · TkA07G307160 · TK1151

Peroxisome0.116

Rank 4 · TkA07G307160 · TK1151

Plastid0.058

Rank 5 · TkA07G307160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03447NAD_binding_310-150 aa

PF00742Homoserine_dh113-128 aa

PF00742Homoserine_dh167-365 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G307160	`PF03447`	NAD_binding_3	10	150	8.6e-07	30.4
TkA07G307160	`PF00742`	Homoserine_dh	113	128	1.3e-49	169.1
TkA07G307160	`PF00742`	Homoserine_dh	167	365	1.3e-49	169.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card