TkA07G287790 | RubberDandelionOmics

Gene overview

TkA07G287790

Reference: TK1151 Chr: Chr07 Coordinates: 72242034-72244024 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1620 bp · TkA07G287790|TK1151|cDNA

AAAACACCGAACACAATTGAGGTTTTCTCTTCCTTCTTATCTGGAATTGCTTTACTTTTCCAGAAAGACTTCTTCATAACCCTAACCTCTCAATTGTTTCTAACTATTGTTTAACTTGAACTACAAGTCAATCAACCACCTCCCCATGCATTCCATCAATCTATATATCTCTATATATACACATTTATATCTATCAATAATCATCCAATCCATGCAAATAATCTCTCAATCTCAATCACAACTCAGAATTTAGATTCATA...

CDS

Download CDS FASTA

987 bp · TkA07G287790|TK1151|CDS

ATGCAAGAAATGGCGAACGAGATAGTCTTCTTTGATTTGGAAACAAACGTGCCAAGAAACCCCGGCCAAAAATTCTGGGTGCTTGAGTTTGGAGCGATGGTGGTTTGCCCAAGAAAGCTTGTCGAGATCGAGAGTTACTCCACATTAATTCGACCTGGAGACTTGTCGGTTGTGGGGGTGAATCCAGCGAGGTGCCATGGGATCTCACGAGGAACGGTTTTGTCAGCTCCCACTTTCGAACAAGTTGCCGATAAGATATT...

Protein

Download Protein FASTA

328 aa · TkA07G287790|TK1151|PROTEIN

MQEMANEIVFFDLETNVPRNPGQKFWVLEFGAMVVCPRKLVEIESYSTLIRPGDLSVVGVNPARCHGISRGTVLSAPTFEQVADKIFEILNGRIWAGHNIQRFDCVRIKAAFEEIGRPAPEPVALIDSLWVLSDKFGKRAGNMKMASLASYFGLGEQKHRSLDDARMNLEVLKHCATVLFLESSLPGILENQWQHNSSPNVTTRSRSTDLMEPSVSTSINKPWSQKESISSSTINNGWNQKESSISRTMNKGWNQESPPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G287790`
TK1151 ID	TkA07G287790
OH-1004 ID	LXL04_029232
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G287790

Location Chr07:72242034-72244024 (-)

Description Similar to NEN4: Protein NEN4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39810`	Probable exonuclease required for enuclation of sieve elements.	No verified direct reference in this release
`At1g74390`	Probable exonuclease that may be involved in enuclation of sieve elements.	No verified direct reference in this release
`At5g07710`	Probable exonuclease involved in enuclation of sieve elements.	No verified direct reference in this release
`At5g61390`	Probable exonuclease involved in enuclation of sieve elements.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029232 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0008408 3'-5' exonuclease activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G74390

ath:AT4G39810

ath:AT5G07710

ath:AT5G61390

tte:TTE1398

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.547

Rank 1 · TkA07G287790 · TK1151

Cytoplasm0.396

Rank 2 · TkA07G287790 · TK1151

Cell membrane0.090

Rank 3 · TkA07G287790 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA07G287790 · TK1151

Mitochondrion0.055

Rank 5 · TkA07G287790 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00929RNase_T9-172 aa

PF16473Rv2179c-like92-174 aa

PF16473Rv2179c-like220-245 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G287790	`PF00929`	RNase_T	9	172	4.7e-27	96.2
TkA07G287790	`PF16473`	Rv2179c-like	92	174	0.14	12.7
TkA07G287790	`PF16473`	Rv2179c-like	220	245	0.14	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JJ23`	Arabidopsis thaliana	sp\|F4JJ23\|NEN4_ARATH Protein NEN4	70.400%	Swiss-Prot	Medium
`Q9CA74`	Arabidopsis thaliana	sp\|Q9CA74\|NEN3_ARATH Protein NEN3	64.500%	Swiss-Prot	Medium
`Q9FLR0`	Arabidopsis thaliana	sp\|Q9FLR0\|NEN1_ARATH Protein NEN1	63.600%	Swiss-Prot	Medium
`Q0V842`	Arabidopsis thaliana	sp\|Q0V842\|NEN2_ARATH Protein NEN2	59.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card