TkA07G286260 | RubberDandelionOmics

Gene overview

TkA07G286260

Reference: TK1151 Chr: Chr07 Coordinates: 71854495-71854982 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

309 bp · TkA07G286260|TK1151|cDNA

CTTACTGATGCTCTTCTGGCAATTGAGGAGGAAAGGGCAATATGGTCCAACACACAAAAAGCTTCGATAGAAGCCATAGAAAGCAAATCAAAGTCTTATACTGCTGAAATTGCTTCATTAACAAATACAATATCAAAGGTGAGGAATGAACTGGCGACCTGCAGCCAAGAATGCCAGATCATCAATGAGAAGTTGAATATGCAGAAAGCCTGCAGTGCTGAGAAGTCACTTGAAGTTGAACAACTTAAGAATGATATTGT...

CDS

Download CDS FASTA

309 bp · TkA07G286260|TK1151|CDS

CTTACTGATGCTCTTCTGGCAATTGAGGAGGAAAGGGCAATATGGTCCAACACACAAAAAGCTTCGATAGAAGCCATAGAAAGCAAATCAAAGTCTTATACTGCTGAAATTGCTTCATTAACAAATACAATATCAAAGGTGAGGAATGAACTGGCGACCTGCAGCCAAGAATGCCAGATCATCAATGAGAAGTTGAATATGCAGAAAGCCTGCAGTGCTGAGAAGTCACTTGAAGTTGAACAACTTAAGAATGATATTGT...

Protein

Download Protein FASTA

102 aa · TkA07G286260|TK1151|PROTEIN

LTDALLAIEEERAIWSNTQKASIEAIESKSKSYTAEIASLTNTISKVRNELATCSQECQIINEKLNMQKACSAEKSLEVEQLKNDIVLLNEQKKISENVSFI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G286260`
TK1151 ID	TkA07G286260
OH-1004 ID	LXL04_029375
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	92.900
Protein coverage (%)	TK1151 96.078 / OH-1004 7.441 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G286260`
Location	Chr07:71854495-71854982 (+)
Description	Similar to KIN7O: Kinesin-like protein KIN-7O
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029375` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000226 microtubule cytoskeleton organization Biological Process GO:0000278 mitotic cell cycle Biological Process GO:0007018 microtubule-based movement Biological Process GO:0008608 attachment of spindle microtubules to kinetochore Biological Process GO:0033044 regulation of chromosome organization Biological Process GO:0042327 positive regulation of phosphorylation Biological Process GO:0140694 membraneless organelle assembly Biological Process GO:1901987 regulation of cell cycle phase transition Biological Process GO:0000776 kinetochore Cellular Component GO:0000779 condensed chromosome, centromeric region Cellular Component GO:0005634 nucleus Cellular Component GO:0005635 nuclear envelope Cellular Component
KEGG gene cross-reference	ath:AT1G59540 ath:AT3G10180 dosa:Os09g0421200 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.624

Rank 1 · TkA07G286260 · TK1151

Nucleus0.297

Rank 2 · TkA07G286260 · TK1151

Golgi apparatus0.061

Rank 3 · TkA07G286260 · TK1151

Mitochondrion0.033

Rank 4 · TkA07G286260 · TK1151

Cell membrane0.033

Rank 5 · TkA07G286260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16515HIP1_clath_bdg2-46 aa

PF08391Ly493-33 aa

PF02841GBP_C7-87 aa

PF26768YtrI_N10-40 aa

PF24161CCDC3915-94 aa

PF12709Fungal_TACC16-50 aa

PF30842LEKR117-84 aa

PF12325TMF_TATA_bd18-87 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G286260	`PF16515`	HIP1_clath_bdg	2	46	0.11	13.6
TkA07G286260	`PF08391`	Ly49	3	33	2.4	9.4
TkA07G286260	`PF02841`	GBP_C	7	87	0.0021	18.2
TkA07G286260	`PF26768`	YtrI_N	10	40	6.8	7.4
TkA07G286260	`PF24161`	CCDC39	15	94	0.004	15.8
TkA07G286260	`PF12709`	Fungal_TACC	16	50	0.48	11.6
TkA07G286260	`PF30842`	LEKR1	17	84	0.036	15.1
TkA07G286260	`PF12325`	TMF_TATA_bd	18	87	0.0018	19.1
TkA07G286260	`PF11488`	Lge1	19	51	0.17	12.8
TkA07G286260	`PF04977`	DivIC	19	48	0.47	11.0
TkA07G286260	`PF07851`	TMEM120A-B	20	87	0.032	14.2
TkA07G286260	`PF16716`	BST2	20	50	0.12	13.7
TkA07G286260	`PF28016`	Mua	22	84	0.02	15.8
TkA07G286260	`PF20149`	DUF6532	23	85	0.021	15.5
TkA07G286260	`PF16454`	PI3K_P85_iSH2	24	93	0.013	15.8
TkA07G286260	`PF11559`	ADIP	24	86	0.023	15.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card