LXL04_029375 | RubberDandelionOmics

Gene overview

LXL04_029375

Reference: OH-1004 Chr: Chr06 Coordinates: 88625094-88632342 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3954 bp · LXL04_029375|LXL04_029375|OH1004|cDNA

ATGGAGAGGATCAACGTTGCAGTGAGAGCAAGACCTCTCTCGCCGGAAGATGCCAAGTGCAGCCCTTGGAGAATTTCCGATAACTCCATTTTGCTCGCAAACCCTACAACCAAGTTCGAATTCGACCGGATTTTCAGAGAGGATTGTAGAACTGTGGATGTTTATGAGTCAAGAACTAAAGCTATTGTTTCCGCTGCTATTGGTGGATTTAATGGCACTGTTTTTGCATATGGACAAACCAACAGTGGCAAAACACATAC...

CDS

Download CDS FASTA

3954 bp · LXL04_029375|LXL04_029375|OH1004|CDS

ATGGAGAGGATCAACGTTGCAGTGAGAGCAAGACCTCTCTCGCCGGAAGATGCCAAGTGCAGCCCTTGGAGAATTTCCGATAACTCCATTTTGCTCGCAAACCCTACAACCAAGTTCGAATTCGACCGGATTTTCAGAGAGGATTGTAGAACTGTGGATGTTTATGAGTCAAGAACTAAAGCTATTGTTTCCGCTGCTATTGGTGGATTTAATGGCACTGTTTTTGCATATGGACAAACCAACAGTGGCAAAACACATAC...

Protein

Download Protein FASTA

1317 aa · LXL04_029375|LXL04_029375|OH1004|PROTEIN

MERINVAVRARPLSPEDAKCSPWRISDNSILLANPTTKFEFDRIFREDCRTVDVYESRTKAIVSAAIGGFNGTVFAYGQTNSGKTHTMRGSSVEPGVIPLAVHDLFDMIQQDVDREFLLRMSYMEIYNEEINDLLAPEHRKLQIHESIERGIFVAGLKEEIVSSPKQVLEFMDFGEAHRHIGETNMNLHSSRSHTIFRMIIESRDKVEDDRAESSCDAVRVSVLNLVDLAGSERAAKTGAEGVRLKEGSHINKSLMTLGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029375`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029375

Location Chr06:88625094-88632342 (-)

Description Similar to KIN7O: Kinesin-like protein KIN-7O

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: F4J2K4`	Kinesin-like protein KIN-7O.	No verified direct reference in this release
`At1g59540`	Kinesin-like protein KIN-7N.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0421200`	Kinesin-like protein KIN-7I.	No verified direct reference in this release
`Os11g0552600`	Kinesin-like protein KIN-7L.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029375 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0000278 mitotic cell cycle Biological Process

GO:0007018 microtubule-based movement Biological Process

GO:0008608 attachment of spindle microtubules to kinetochore Biological Process

GO:0033044 regulation of chromosome organization Biological Process

GO:0042327 positive regulation of phosphorylation Biological Process

GO:0140694 membraneless organelle assembly Biological Process

GO:1901987 regulation of cell cycle phase transition Biological Process

GO:0000776 kinetochore Cellular Component

GO:0000779 condensed chromosome, centromeric region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

KEGG gene cross-reference

ath:AT1G59540

ath:AT3G10180

dosa:Os09g0421200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.713

Rank 1 · LXL04_029375 · OH-1004

Nucleus0.243

Rank 2 · LXL04_029375 · OH-1004

Cell membrane0.096

Rank 3 · LXL04_029375 · OH-1004

Golgi apparatus0.090

Rank 4 · LXL04_029375 · OH-1004

Lysosome / Vacuole0.045

Rank 5 · LXL04_029375 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00225.30Kinesin33-324 aa

PF16796.12Microtub_bd34-135 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029375	`PF00225.30`	Kinesin	33	324	2e-106	356.4
LXL04_029375	`PF16796.12`	Microtub_bd	34	135	6e-20	72.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J2K4`	Arabidopsis thaliana	Kinesin-like protein KIN-7O	57.683%	Swiss-Prot	moderate database homology
`Q9S7P3`	Arabidopsis thaliana	Kinesin-like protein KIN-7N	55.819%	Swiss-Prot	weak database homology
`B9G3M6`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-7I	58.520%	Swiss-Prot	moderate database homology
`Q2R2P7`	Oryza sativa subsp. japonica	Kinesin-like protein KIN-7L	57.919%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card