Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2505 bp · TkA07G280380|TK1151|cDNA
TCTCAATGTCACTATTTGCAGCCATACAGTTCATAATATTCATCGCATGAATAATACTAATTCCAACGCCGTCCTTTTGTTGTTCCTACTTTGCTTGATCAAATCCACAATTTCATAATGTCTTTCTTGAGAACCATGTATATGCTCCCTCATTAAAGCAGAGCCTCATGAATTGATATATGTTCCAGAATCTGACTCACAAACCTAAAGTTGACCCATGAACCCGAAGTCGACCCGCCAGCCCGAATTTGACCCATGAA...
1497 bp · TkA07G280380|TK1151|CDS
ATGATTTCAGCAATATCATGGGTTCCTAAAGGGGCTTCCAAATCTGTCCCTGCGGCAGCTGATCCTCCTTCAAAAGAGGAAATCGAGGAGATAAAGAAGACAGTCCTCGTGGGACAAGGTGTAGATGTTGAAAGCGAGGAAGATGATGAAGATATGAGTGTTGATGCGACTAAGCAACCTGCTGATATTGAGCAGGCGTTAGGTGCAGCTAATGCACTTGGTAAGGTTTCTACAAGGAAAACTGGTGGATCTAACCTCGC...
Protein
Download Protein FASTA498 aa · TkA07G280380|TK1151|PROTEIN
MISAISWVPKGASKSVPAAADPPSKEEIEEIKKTVLVGQGVDVESEEDDEDMSVDATKQPADIEQALGAANALGKVSTRKTGGSNLADIADGLDELNMDDYDDEDDAVDIFGSGLGDTFYPSNELDPYIKDKDDDEDSEELDDVIIKADDAVVVCARNEDDMSHLEVWIVEDPDGDSNMYVHHDILIPAFPLCTAWLDCPIKGGEKGNFIAVGSMEPAIEIWDLDVMDEVQPSLILGGVADKKKKKKGKKTEKSIKYKED...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G280380 |
|---|---|
| TK1151 ID | TkA07G280380 |
| OH-1004 ID | LXL04_029150 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 89.300 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G280380 |
|---|---|
| Location | Chr07:70100014-70104720 (-) |
| Description | Similar to PWP1: Periodic tryptophan protein 1 homolog |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006351 DNA-templated transcription Biological Process GO:0006364 rRNA processing Biological Process GO:0045892 negative regulation of DNA-templated transcription Biological Process GO:1901838 positive regulation of transcription of nucleolar large rRNA by RNA polymerase I Biological Process GO:2000738 positive regulation of stem cell differentiation Biological Process GO:0005634 nucleus Cellular Component GO:0005694 chromosome Cellular Component GO:0005730 nucleolus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005829 cytosol Cellular Component GO:1990889 histone H4K20me3 reader activity Molecular Function |
| KEGG gene cross-reference | bta:514147 hsa:11137 mmu:103136 sce:YLR196W spo:2539789 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF23798Beta-prop_SPT8123-171 aaPF18543ID142-159 aaPF23419WD40_RFWD3148-171 aaPF25391WD40_Gbeta188-226 aaPF24807WD40_CDC20-Fz204-227 aaPF25173Beta-prop_WDR3_1st205-225 aaPF24796WDR55205-225 aaPF24105Beta-prop_CAF1B_HIR1205-329 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G280380 | PF23798 | Beta-prop_SPT8 | 123 | 171 | 0.38 | 10.3 |
| TkA07G280380 | PF18543 | ID | 142 | 159 | 0.19 | 12.8 |
| TkA07G280380 | PF23419 | WD40_RFWD3 | 148 | 171 | 4.2e-16 | 59.9 |
| TkA07G280380 | PF25391 | WD40_Gbeta | 188 | 226 | 1.8e-12 | 47.7 |
| TkA07G280380 | PF24807 | WD40_CDC20-Fz | 204 | 227 | 7.9e-32 | 111.4 |
| TkA07G280380 | PF25173 | Beta-prop_WDR3_1st | 205 | 225 | 4.3e-25 | 89.2 |
| TkA07G280380 | PF24796 | WDR55 | 205 | 225 | 2.9e-13 | 50.2 |
| TkA07G280380 | PF24105 | Beta-prop_CAF1B_HIR1 | 205 | 329 | 4.1e-11 | 43.2 |
| TkA07G280380 | PF20426 | NBCH_WD40 | 205 | 224 | 0.00067 | 19.3 |
| TkA07G280380 | PF25174 | Beta-prop_THOC3 | 206 | 481 | 8.9e-34 | 117.4 |
| TkA07G280380 | PF23381 | Beta-prop_IFT122_1st | 206 | 224 | 1.1e-26 | 94.5 |
| TkA07G280380 | PF25175 | Beta-prop_WDR5 | 206 | 225 | 1.4e-26 | 94.2 |
| TkA07G280380 | PF24817 | WD40_WDHD1_1st | 206 | 226 | 5.7e-14 | 52.7 |
| TkA07G280380 | PF23414 | Beta-prop_EML_2 | 206 | 225 | 2.9e-13 | 50.5 |
| TkA07G280380 | PF25047 | Beta-prop_TEP1_2nd | 206 | 234 | 6.5e-13 | 49.2 |
| TkA07G280380 | PF24782 | WD40_MABP1-WDR62_2nd | 206 | 230 | 1.4e-12 | 47.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.