TkA07G271360 | RubberDandelionOmics

Gene overview

TkA07G271360

Reference: TK1151 Chr: Chr07 Coordinates: 67835304-67844510 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3045 bp · TkA07G271360|TK1151|cDNA

ATGGCCGCTAACCTACTTCTTGGTCTCGCTGCCAACTCCAACCCTGGTAACTTCCAAATTCCTTCCCTCAGCATAAAATTGAATCAGAACAATTTCTCCCTATGGCGCTCTACCATTATTTCTGCGCTGGAGACTTTTGATCTGGAAAGCTTCGTTCTTTCCCCTGACCCACCTGCTGCGACCATCTCTGTTCCTTCTGCTGCTGGTACAAAAGGCCCTCCGACAATTGAAGCTAATCCCGCCCTTGTTTCTTGGAAAAA...

CDS

Download CDS FASTA

3045 bp · TkA07G271360|TK1151|CDS

ATGGCCGCTAACCTACTTCTTGGTCTCGCTGCCAACTCCAACCCTGGTAACTTCCAAATTCCTTCCCTCAGCATAAAATTGAATCAGAACAATTTCTCCCTATGGCGCTCTACCATTATTTCTGCGCTGGAGACTTTTGATCTGGAAAGCTTCGTTCTTTCCCCTGACCCACCTGCTGCGACCATCTCTGTTCCTTCTGCTGCTGGTACAAAAGGCCCTCCGACAATTGAAGCTAATCCCGCCCTTGTTTCTTGGAAAAA...

Protein

Download Protein FASTA

1014 aa · TkA07G271360|TK1151|PROTEIN

MAANLLLGLAANSNPGNFQIPSLSIKLNQNNFSLWRSTIISALETFDLESFVLSPDPPAATISVPSAAGTKGPPTIEANPALVSWKKKDQIVLLWIKSPLYSLFLYTHSSGFPLSLSTISLSIGEHYHPAAHNLWLQALTLRSLFSPSRQIGFSDRTGNRDLKIKDCELKDRPCNKRVQGLPVIKGAITVNTNSWTNAGHATNQIYDLLYMMDRDDIVVGVGGEGGISQNGKILPNVGGYLPIIDQGSGTGGPCRYRQAI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G271360`
TK1151 ID	TkA07G271360
OH-1004 ID	LXL04_029090
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	79.400
Protein coverage (%)	TK1151 99.901 / OH-1004 63.023 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G271360

Location Chr07:67835304-67844510 (+)

Description Similar to URH1: Uridine nucleosidase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18860`	Extracellular purine-specific hydrolase present in the apoplastic fluid involved in the degradation of extracellular nucleosides, including inosine and adenosine, and which may participate in wound and pathogen responses (e.g. Botrytis cinerea).	Arabidopsis nucleoside hydrolases involved in intracellular and extracellular degradation of purines.2011 · DOI: 10.1111/j.1365-313x.2010.04455.x Apoplastic Nucleoside Accumulation in Arabidopsis Leads to Reduced Photosynthetic Performance and Increased Susceptibility Against Botrytis cinerea.2015 · DOI: 10.3389/fpls.2015.01158
`At5g18890`	May be involved in the degradation of nucleosides.	No verified direct reference in this release
`At5g18870`	May be involved in the degradation of extracellular nucleosides.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029090 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006148 inosine catabolic process Biological Process

GO:0006154 adenosine catabolic process Biological Process

GO:0009611 response to wounding Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048046 apoplast Cellular Component

GO:0016799 hydrolase activity, hydrolyzing N-glycosyl compounds Molecular Function

GO:0047622 adenosine nucleosidase activity Molecular Function

GO:0047724 inosine nucleosidase activity Molecular Function

KEGG gene cross-reference

ath:AT5G18860

ath:AT5G18890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.262

Rank 1 · TkA07G271360 · TK1151

Lysosome / Vacuole0.247

Rank 2 · TkA07G271360 · TK1151

Endoplasmic reticulum0.203

Rank 3 · TkA07G271360 · TK1151

Cytoplasm0.157

Rank 4 · TkA07G271360 · TK1151

Cell membrane0.113

Rank 5 · TkA07G271360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14244Retrotran_gag_322-44 aa

PF01156IU_nuc_hydro188-497 aa

PF01156IU_nuc_hydro630-968 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G271360	`PF14244`	Retrotran_gag_3	22	44	0.067	13.7
TkA07G271360	`PF01156`	IU_nuc_hydro	188	497	2.6e-64	218.5
TkA07G271360	`PF01156`	IU_nuc_hydro	630	968	2.6e-64	218.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RY23`	Arabidopsis thaliana	sp\|Q8RY23\|NSH3_ARATH Nucleoside hydrolase 3	64.100%	Swiss-Prot	High
`F4JZJ2`	Arabidopsis thaliana	sp\|F4JZJ2\|NSH4_ARATH Nucleoside hydrolase 4	59.300%	Swiss-Prot	Medium
`F4JZJ0`	Arabidopsis thaliana	sp\|F4JZJ0\|NSH5_ARATH Nucleoside hydrolase 5	61.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card