LXL04_029090 | RubberDandelionOmics

Gene overview

LXL04_029090

Reference: OH-1004 Chr: Chr06 Coordinates: 80536266-80551612 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5163 bp · LXL04_029090|LXL04_029090|OH1004|cDNA

ATGGCCGCTAACCTACTTCTTGGTCTCGCTGCCAACTCCAACCCTGGTAACTTCCAAATTCCTTCCCTCAGCATAAAATTGAATCAGAACAATTTCTCCCTATGGCGCTCTACCATTATTTCTGCGCTGGAGACTTTTGATCTGGAAAGCTTCGTTCTTTCCCCTGACCCACCTGCTGCGACCATCTCTGTTCCTTCTGCTGCTGGTACAAAAGGCCCTCCGACAATTGAAGCTAATCCCGCCCTTGTTTCTTGGAAAAA...

CDS

Download CDS FASTA

5163 bp · LXL04_029090|LXL04_029090|OH1004|CDS

ATGGCCGCTAACCTACTTCTTGGTCTCGCTGCCAACTCCAACCCTGGTAACTTCCAAATTCCTTCCCTCAGCATAAAATTGAATCAGAACAATTTCTCCCTATGGCGCTCTACCATTATTTCTGCGCTGGAGACTTTTGATCTGGAAAGCTTCGTTCTTTCCCCTGACCCACCTGCTGCGACCATCTCTGTTCCTTCTGCTGCTGGTACAAAAGGCCCTCCGACAATTGAAGCTAATCCCGCCCTTGTTTCTTGGAAAAA...

Protein

Download Protein FASTA

1720 aa · LXL04_029090|LXL04_029090|OH1004|PROTEIN

MAANLLLGLAANSNPGNFQIPSLSIKLNQNNFSLWRSTIISALETFDLESFVLSPDPPAATISVPSAAGTKGPPTIEANPALVSWKKKDQIVLLDDIVVGVGGEGGISQNGKILPNVGGYLPIIDQKRNRIVQPNRSSPPDMNSTRSPVHELRPRPGSGTRSRDSSITDLGHHRHSSDVLGNDQQVPGHHRQHPDHPRVAIQVTRTPPRTNLVATKSTDAHQLFDDMPTRQRSGFLGHHRTLLGQISASDQNARTHTNCS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029090`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029090

Location Chr06:80536266-80551612 (+)

Description Similar to URH1: Uridine nucleosidase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g18860`	Extracellular purine-specific hydrolase present in the apoplastic fluid involved in the degradation of extracellular nucleosides, including inosine and adenosine, and which may participate in wound and pathogen responses (e.g. Botrytis cinerea).	Arabidopsis nucleoside hydrolases involved in intracellular and extracellular degradation of purines.2011 · DOI: 10.1111/j.1365-313x.2010.04455.x Apoplastic Nucleoside Accumulation in Arabidopsis Leads to Reduced Photosynthetic Performance and Increased Susceptibility Against Botrytis cinerea.2015 · DOI: 10.3389/fpls.2015.01158
`At5g18890`	May be involved in the degradation of nucleosides.	No verified direct reference in this release
`At5g18870`	May be involved in the degradation of extracellular nucleosides.	No verified direct reference in this release
`At2g36310`	Involved in purine and pyrimidine breakdown rather than in pyrimidine salvage, especially in response to dark stress.	Uridine-ribohydrolase is a key regulator in the uridine degradation pathway of Arabidopsis.2009 · DOI: 10.1105/tpc.108.062612 Arabidopsis nucleoside hydrolases involved in intracellular and extracellular degradation of purines.2011 · DOI: 10.1111/j.1365-313x.2010.04455.x Arabidopsis thaliana nucleosidase mutants provide new insights into nucleoside degradation.2011 · DOI: 10.1111/j.1469-8137.2011.03711.x AMP and GMP Catabolism in Arabidopsis Converge on Xanthosine, Which Is Degraded by a Nucleoside Hydrolase Heterocomplex.2019 · DOI: 10.1105/tpc.18.00899

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029090 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006148 inosine catabolic process Biological Process

GO:0006154 adenosine catabolic process Biological Process

GO:0009611 response to wounding Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0048046 apoplast Cellular Component

GO:0016799 hydrolase activity, hydrolyzing N-glycosyl compounds Molecular Function

GO:0047622 adenosine nucleosidase activity Molecular Function

GO:0047724 inosine nucleosidase activity Molecular Function

KEGG gene cross-reference

ath:AT5G18860

ath:AT5G18890

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.297

Rank 1 · LXL04_029090 · OH-1004

Lysosome / Vacuole0.265

Rank 2 · LXL04_029090 · OH-1004

Cytoplasm0.222

Rank 3 · LXL04_029090 · OH-1004

Endoplasmic reticulum0.150

Rank 4 · LXL04_029090 · OH-1004

Cell membrane0.111

Rank 5 · LXL04_029090 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01156.25IU_nuc_hydro355-567 aa

PF01156.25IU_nuc_hydro701-1038 aa

PF01156.25IU_nuc_hydro1093-1294 aa

PF01156.25IU_nuc_hydro1430-1694 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029090	`PF01156.25`	IU_nuc_hydro	355	567	4.6e-126	421.2
LXL04_029090	`PF01156.25`	IU_nuc_hydro	701	1038	4.6e-126	421.2
LXL04_029090	`PF01156.25`	IU_nuc_hydro	1093	1294	4.6e-126	421.2
LXL04_029090	`PF01156.25`	IU_nuc_hydro	1430	1694	4.6e-126	421.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RY23`	Arabidopsis thaliana	Nucleoside hydrolase 3	62.601%	Swiss-Prot	weak database homology
`F4JZJ2`	Arabidopsis thaliana	Nucleoside hydrolase 4	60.038%	Swiss-Prot	weak database homology
`F4JZJ0`	Arabidopsis thaliana	Nucleoside hydrolase 5	54.264%	Swiss-Prot	weak database homology
`Q9SJM7`	Arabidopsis thaliana	Uridine nucleosidase 1	27.519%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card