TkA07G260330 | RubberDandelionOmics

Gene overview

TkA07G260330

Reference: TK1151 Chr: Chr07 Coordinates: 65091858-65093417 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1413 bp · TkA07G260330|TK1151|cDNA

ATGCACCATATACAATCGCTATTGCCGGTTAAAGAAGCGGCCCGCACCGGTGTCTTGTCCAAGTCATGGCTACACGCTTGGTCTACCATCCCTAACCTCAGGTTTCATGAGCACATGAAGTTGGCGGACGTTGACCGTAGTCTGGTAAGATATCTCCGTGACGACATACCAATTGAAAGGTTTGAACTTAAGATCGATATCCAGAATCAGAAGTCCGCTGCTCTTGCTCAAAAATGGATCCGAAGCGTGGCAACCAAAAC...

CDS

Download CDS FASTA

1413 bp · TkA07G260330|TK1151|CDS

ATGCACCATATACAATCGCTATTGCCGGTTAAAGAAGCGGCCCGCACCGGTGTCTTGTCCAAGTCATGGCTACACGCTTGGTCTACCATCCCTAACCTCAGGTTTCATGAGCACATGAAGTTGGCGGACGTTGACCGTAGTCTGGTAAGATATCTCCGTGACGACATACCAATTGAAAGGTTTGAACTTAAGATCGATATCCAGAATCAGAAGTCCGCTGCTCTTGCTCAAAAATGGATCCGAAGCGTGGCAACCAAAAC...

Protein

Download Protein FASTA

470 aa · TkA07G260330|TK1151|PROTEIN

MHHIQSLLPVKEAARTGVLSKSWLHAWSTIPNLRFHEHMKLADVDRSLVRYLRDDIPIERFELKIDIQNQKSAALAQKWIRSVATKTSLKELSLTISPSGASLHLPEELLSGENLIKITVSASQGPKPNSIWMTTTHHPKCVTSLRELHFSCVTVSEQVLHDIFSSCSSLVKIELILCSQGLNTIKVKNLHCLRQLQIVTSDGGSTAFEISHLKSLRMLGCNVRMNGRSKRLSIPPLINGHSISLGTGVTELTLGGGMIM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G260330`
TK1151 ID	TkA07G260330
OH-1004 ID	LXL04_028999
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.000
Protein coverage (%)	TK1151 100.000 / OH-1004 96.468 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G260330`
Location	Chr07:65091858-65093417 (-)
Description	Similar to At3g59230: Putative F-box/LRR-repeat protein At3g59230
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028999` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005634 nucleus Cellular Component GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference	ath:AT1G48400 ath:AT3G26922 ath:AT3G59200 ath:AT3G59230 ath:AT5G56410 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.835

Rank 1 · TkA07G260330 · TK1151

Cytoplasm0.190

Rank 2 · TkA07G260330 · TK1151

Cell membrane0.065

Rank 3 · TkA07G260330 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA07G260330 · TK1151

Plastid0.018

Rank 5 · TkA07G260330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23622LRR_At1g61320_AtMIF158-200 aa

PF23598LRR_1462-160 aa

PF24758LRR_At5g5637077-208 aa

PF25019LRR_R13L1-DRL2186-198 aa

PF13981SopA141-167 aa

PF23598LRR_14160-224 aa

PF24758LRR_At5g56370251-311 aa

PF13981SopA392-436 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G260330	`PF23622`	LRR_At1g61320_AtMIF1	58	200	1e-09	39.0
TkA07G260330	`PF23598`	LRR_14	62	160	0.0064	16.0
TkA07G260330	`PF24758`	LRR_At5g56370	77	208	5e-11	43.4
TkA07G260330	`PF25019`	LRR_R13L1-DRL21	86	198	0.74	10.4
TkA07G260330	`PF13981`	SopA	141	167	0.23	12.2
TkA07G260330	`PF23598`	LRR_14	160	224	0.0064	16.0
TkA07G260330	`PF24758`	LRR_At5g56370	251	311	5e-11	43.4
TkA07G260330	`PF13981`	SopA	392	436	0.23	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card