TkA07G244950 | RubberDandelionOmics

Gene overview

TkA07G244950

Reference: TK1151 Chr: Chr07 Coordinates: 61115654-61117587 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

963 bp · TkA07G244950|TK1151|cDNA

ATGTTTAAAGGACTCAAGCATAGCATCCCTCATCCAATTTTTTCAAAAGCCCCTTACAGCTGGAAATTGGGGCTTTTTAACTATCTTCCACCGGAACGCCTTTTCATCTTTTCAATATTCCTTTGCGACGCGGCTTTACTTCTTCCACCTGCCCGCCATTACTTCTTCCAATCGCCATTACTTCCTCGTCCCTTTCCCCCCTTCATTCAATCCTTCAAACCCACCTCCTCAATCCTCATCATCATCCTCATCTTCTTCCT...

CDS

Download CDS FASTA

963 bp · TkA07G244950|TK1151|CDS

ATGTTTAAAGGACTCAAGCATAGCATCCCTCATCCAATTTTTTCAAAAGCCCCTTACAGCTGGAAATTGGGGCTTTTTAACTATCTTCCACCGGAACGCCTTTTCATCTTTTCAATATTCCTTTGCGACGCGGCTTTACTTCTTCCACCTGCCCGCCATTACTTCTTCCAATCGCCATTACTTCCTCGTCCCTTTCCCCCCTTCATTCAATCCTTCAAACCCACCTCCTCAATCCTCATCATCATCCTCATCTTCTTCCT...

Protein

Download Protein FASTA

320 aa · TkA07G244950|TK1151|PROTEIN

MFKGLKHSIPHPIFSKAPYSWKLGLFNYLPPERLFIFSIFLCDAALLLPPARHYFFQSPLLPRPFPPFIQSFKPTSSILIIILIFFLYYYANLPQSVPSSLTQIKLIQEDLDAKIKPQLWDPKTMLSNLSIMEEKVHQLQELVQLIVSKSSINQSNDFLIQQQQLVTADLTSIIIQLISTADSLLPNVKHPHFSPNPDPNPNTNTNTHTTHKNKPAAGFLDDLSGRVSRFHLHSLSILNLAVKTHFSRISTAATVTMTAD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G244950`
TK1151 ID	TkA07G244950
OH-1004 ID	LXL04_031412
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	77.400
Protein coverage (%)	TK1151 43.438 / OH-1004 32.653 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G244950

Location Chr07:61115654-61117587 (-)

Description Similar to STOP1: Protein SENSITIVE TO PROTON RHIZOTOXICITY 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g34370`	Probable transcription factor.	Zinc finger protein STOP1 is critical for proton tolerance in Arabidopsis and coregulates a key gene in aluminum tolerance.2007 · DOI: 10.1073/pnas.0700117104 Aluminum-activated citrate and malate transporters from the MATE and ALMT families function independently to confer Arabidopsis aluminum tolerance.2009 · DOI: 10.1111/j.1365-313x.2008.03696.x STOP1 regulates multiple genes that protect arabidopsis from proton and aluminum toxicities.2009 · DOI: 10.1104/pp.108.134700 STOP2 activates transcription of several genes for Al- and low pH-tolerance that are regulated by STOP1 in Arabidopsis.2014 · DOI: 10.1093/mp/sst116

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0871200`	Probable transcription factor that may be involved in aluminum tolerance.	No verified direct reference in this release
`Os12g0170400`	Transcriptional activator that regulates the expression of genes involved in aluminum (Al) tolerance.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031412 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0010044 response to aluminum ion Biological Process

GO:0010447 response to acidic pH Biological Process

GO:0010468 regulation of gene expression Biological Process

GO:0042542 response to hydrogen peroxide Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0071453 cellular response to oxygen levels Biological Process

GO:0071472 cellular response to salt stress Biological Process

GO:0080022 primary root development Biological Process

GO:1900037 regulation of cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G34370

ath:AT1G51220

ath:AT5G22890

dosa:Os01g0871200

dosa:Os12g0170400

osa:4324940

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.317

Rank 1 · TkA07G244950 · TK1151

Cytoplasm0.223

Rank 2 · TkA07G244950 · TK1151

Endoplasmic reticulum0.208

Rank 3 · TkA07G244950 · TK1151

Mitochondrion0.155

Rank 4 · TkA07G244950 · TK1151

Cell membrane0.069

Rank 5 · TkA07G244950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07853DUF164878-98 aa

PF25089DUF7804293-317 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G244950	`PF07853`	DUF1648	78	98	0.19	12.1
TkA07G244950	`PF25089`	DUF7804	293	317	0.003	18.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C8N5`	Arabidopsis thaliana	sp\|Q9C8N5\|STOP1_ARATH Protein SENSITIVE TO PROTON RHIZOTOXICITY 1	56.500%	Swiss-Prot	Low
`Q943I6`	Oryza sativa subsp. japonica	sp\|Q943I6\|STOP1_ORYSJ Zinc finger protein STOP1 homolog	45.900%	Swiss-Prot	Low
`Q2QX40`	Oryza sativa subsp. japonica	sp\|Q2QX40\|ART1_ORYSJ Zinc finger protein STAR3	44.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card