TkA07G176590 | RubberDandelionOmics

Gene overview

TkA07G176590

Reference: TK1151 Chr: Chr07 Coordinates: 45165343-45167501 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

783 bp · TkA07G176590|TK1151|cDNA

TTCAGATCCGAAGAACAGAGTAATTTGCAGATCGTGGAACGTGAAGAGCTTGAGGATGAAGAAGATCTATTTGAAGCCATTGATAAACTGACTTCTCATGGAATAAATGCTGGAGATGTTAAAAAGCTGCAGGACGCGGGAATCTATACTTGCAATGGCCTGATGATGCACACAAAGAAGAGCTTGACTGGTATAAAAGGTCTATCGGAGGCTAAAGTTGATAAAATATGTGAAGCTGCCGAGAAGTTAGTGAATTTTGG...

CDS

Download CDS FASTA

783 bp · TkA07G176590|TK1151|CDS

TTCAGATCCGAAGAACAGAGTAATTTGCAGATCGTGGAACGTGAAGAGCTTGAGGATGAAGAAGATCTATTTGAAGCCATTGATAAACTGACTTCTCATGGAATAAATGCTGGAGATGTTAAAAAGCTGCAGGACGCGGGAATCTATACTTGCAATGGCCTGATGATGCACACAAAGAAGAGCTTGACTGGTATAAAAGGTCTATCGGAGGCTAAAGTTGATAAAATATGTGAAGCTGCCGAGAAGTTAGTGAATTTTGG...

Protein

Download Protein FASTA

260 aa · TkA07G176590|TK1151|PROTEIN

FRSEEQSNLQIVEREELEDEEDLFEAIDKLTSHGINAGDVKKLQDAGIYTCNGLMMHTKKSLTGIKGLSEAKVDKICEAAEKLVNFGYITGSDALLRRKAVVRITTGSQALDELLGGGIETLQITEAFGEFRSGKTQLAHTLCVSTQLPTNMKGGNGKVAYIDTEGTFRPDRIVPIAERFGMDAGAVLDNIIYARAYTYEHQYNLLLGLAAKMSEEPFRLLIVDSVIALFRVDFTGRRTCRAPAKVGSDALPTNKDCRRV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G176590`
TK1151 ID	TkA07G176590
OH-1004 ID	LXL04_018563
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	54.500
Protein coverage (%)	TK1151 81.154 / OH-1004 60.632 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G176590

Location Chr07:45165343-45167501 (-)

Description Similar to RAD51: DNA repair protein RAD51 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g22880`	May participate in meiotic recombination, specifically in homologous strand assimilation, which is required for the resolution of meiotic double-strand breaks.	Random chromosome segregation without meiotic arrest in both male and female meiocytes of a dmc1 mutant of Arabidopsis.1999 · DOI: 10.1105/tpc.11.9.1623 ASY1 mediates AtDMC1-dependent interhomolog recombination during meiosis in Arabidopsis.2007 · DOI: 10.1101/gad.439007 MCM8 is required for a pathway of meiotic double-strand break repair independent of DMC1 in Arabidopsis thaliana.2013 · DOI: 10.1371/journal.pgen.1003165

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q7EAG4`	Recombinase that may participate in meiotic recombination, specifically in homologous strand assimilation, which is required for the resolution of meiotic double-strand breaks (By similarity).	No verified direct reference in this release
`Os11g0146800`	Recombinase that may participate in meiotic recombination, specifically in homologous strand assimilation, which is required for the resolution of meiotic double-strand breaks (By similarity).	Filament formation and robust strand exchange activities of the rice DMC1A and DMC1B proteins.2008 · DOI: 10.1093/nar/gkn405 OsDMC1 Is Not Required for Homologous Pairing in Rice Meiosis.2016 · DOI: 10.1104/pp.16.00167

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018563 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000722 telomere maintenance via recombination Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0000730 DNA recombinase assembly Biological Process

GO:0006259 DNA metabolic process Biological Process

GO:0006281 DNA repair Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006312 mitotic recombination Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0009314 response to radiation Biological Process

KEGG gene cross-reference

ath:AT5G20850

hsa:5888

sly:544003

zma:541709

zma:541710

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.478

Rank 1 · TkA07G176590 · TK1151

Cytoplasm0.468

Rank 2 · TkA07G176590 · TK1151

Mitochondrion0.095

Rank 3 · TkA07G176590 · TK1151

Plastid0.034

Rank 4 · TkA07G176590 · TK1151

Cell membrane0.033

Rank 5 · TkA07G176590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14579HHH_610-51 aa

PF14520HHH_533-82 aa

PF22357AF1548-like_C34-84 aa

PF14579HHH_661-82 aa

PF08423Rad5197-238 aa

PF00154RecA_N98-229 aa

PF06745ATPase105-196 aa

PF14520HHH_5114-122 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G176590	`PF14579`	HHH_6	10	51	0.039	14.9
TkA07G176590	`PF14520`	HHH_5	33	82	9.7e-05	23.5
TkA07G176590	`PF22357`	AF1548-like_C	34	84	0.19	12.6
TkA07G176590	`PF14579`	HHH_6	61	82	0.039	14.9
TkA07G176590	`PF08423`	Rad51	97	238	3.1e-69	233.6
TkA07G176590	`PF00154`	RecA_N	98	229	2.1e-06	28.1
TkA07G176590	`PF06745`	ATPase	105	196	0.0055	16.8
TkA07G176590	`PF14520`	HHH_5	114	122	9.7e-05	23.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39009`	Arabidopsis thaliana	sp\|Q39009\|DMC1_ARATH Meiotic recombination protein DMC1 homolog	86.500%	Swiss-Prot	High
`Q7EAG4`	Oryza sativa subsp. indica	sp\|Q7EAG4\|DMC1B_ORYSI Meiotic recombination protein DMC1 homolog B	86.900%	Swiss-Prot	High
`Q7GBF7`	Oryza sativa subsp. japonica	sp\|Q7GBF7\|DMC1B_ORYSJ Meiotic recombination protein DMC1 homolog B	86.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card